--

نوع المقالة : بحث

الملخص
--

103
Bas.J.Vet.Res.Vol.19, No.2, 2020.
VIRULENCE POTENTIAL OF S. aureus ISOLATED FROM IMPORTED
AND LOCAL CHICKEN DEPENDING ON THE PHENOL SOLUBLE
MODULINS (PSMMEC) IN DUHOK PROVINCE, KURDISTAN REGION
OF IRAQ
Nacheervan Majeed Ghaffar
College of veterinary medicine, Duhok research center, University of Duhok
(Received 4 July 2020 ,Accepted 14 July 2020)
Key word: (SCC), PSM, mecA
Corresponding Author: Nacheervan.ghaffar@uod.ac
ABSTRACT
Staphylococcus aureus is considered as one of the major foodborne pathogens in human
and animals which can lead to a wide range of diseases, including food poisoning. The toxins of
S. aureus play an important role in disease pathogenesis, contributing to both injury of the host
tissues and the immune response. One of these toxins is phenol-soluble modulin (PSM) peptides
which has the ability of immune invasion and considered as a cytolytic toxin. Commonly, mobile
genetic elements (MGE) of S. aureus that carrying antibiotic resistance gene do not carry the
virulence genes, however, PSMmec has been identified within the methicillin resistance
staphylococcus-encoding MGE SCCmec. This study was conducted for six months, over-all 200
whole chicken carcasses were collected including (100) local chicken and (100) imported one
from supermarkets in Duhok province. The samples for S. aureus were cultured on mannitol salt
agar and then were confirmed using colony morphology, biochemical test like, catalase test and
coagulase test, in addition to the species specific primer (nuc gene) for PCR. The PCR positive
samples were selected and used in this study. The aim of this study was to evaluate the virulence
potential of S. aureus isolated from imported and local chickens depending on PSMmec-complex
PCR (spanning PSM, xylR and mecR genes) and mecA. The results of this study shows that 46
isolates out of 57 from imported chickens were carried mecA (methicillin resistant isolates) from
104
Bas.J.Vet.Res.Vol.19, No.2, 2020.
these 28 isolates harbored PSMmec gene. Regarding to the local chicken, only 2 isolates out of
18 carries together both PSMmec and mecA. According to the PSM-complex tested in this study,
S. aureus isolates from imported chickens have SCCmec elements (SCCmec, II (2A) and IID,
while the local chicken isolates have just SCCmec IID. Isolates resistance to methicillin with
PSM may contribute to staphylococcal virulence. The outcomes of present study suggest that
isolates from imported chicken were more virulent comparing with local isolates. This study
needs further confirmation by amplification of SCC elements and sequencing them to determine
the proper genetic structures of these regions.
INTRODUCTION
Staphylococcus aureus is the most common foodborne pathogen distributed all over the
world. These microorganism carriers a virulence gene called phenol-soluble modulins (PSMs),
comparing with other virulence factors, this gene is α-helical peptides and has the ability to play
a role as pro-inflammatory cytolytic toxins (1). Antibiotic resistance genes are normally located
on mobile genetic elements (MGEs) like plasmids, genomic islands and, transposons (2). The
methicillin resistance gene (mecA) is specifically situated in the staphylococcal cassette
chromosome-mec (SCCmec). At least four main and many sub-types of SCCmec elements are
introduced, their sizes ranging from 21 to 67 kb, these elements are characterized by two
important gene complexes (mec and ccr) and transposons as an accessory gene loci (2).
PSM gene has been described by (3), In methicillin-resistant S. aureus (MRSA). Kaito et
al., 2008, found that the PSM-mec, partly overlaps the open reading frame of a putative
virulence-modulating, “fudoh” (4). It was determined that PSM-mec is found within SCCmec
elements genes which include the genes responsible for mecA, recombinase genes, regulatory
elements and inconsistently other resistance genes (5–7). In these elements, the merely known
related virulence factor is PSM-mec. This gene has been identified in S. aureus SCCmec types II,
III and VIII, SCCmec types II and III in S. epidermidis as well as found in S. cohnii, S.
saprophyticus, S. sciurii and S. vitulinus (3). The virulent of S. aureus infection is mostly
determined by the ability of S. aureus toxins to make an infection. For example, S. aureus may
produce phenol-soluble modulins (PSMs), toxic shock syndrome toxin-1, enterotoxins,
leukocidins, a-toxin and other toxins (8–10). Many of them have the ability to destroy immune
105
Bas.J.Vet.Res.Vol.19, No.2, 2020.
cells, thus contributing significantly to the immune evasion capacity of S. aureus. Many S.
aureus toxins are encoded on the bacterial core genome such as a-toxin and PSMs (1,11).
This study was aimed to screen S. aureus isolated from imported and local chicken for
the presence of PSM-mec complex associated with mecA in order to obtain more data on its
distribution and to determine the virulence potential of these isolates as this gene is considered as
a virulence determinant that connects the transcriptional regulation, virulence in staphylococci.
MATERIAL AND METHODS
This study was conducted for six months from March, 2019 to September 2019.
Sample collection
A total of 200 whole chickens were scanned for the detection of S. aureus (100 of local
chickens and 100 of imported chickens). Local fresh chicken were collected from the Duhok
chicken abattoir in Summel, Duhok province. While, the whole imported chicken carcasses were
collected from different supermarkets in Duhok city (Turkish origin). These carcasses were
collected and transferred immediately in a cold box to the Microbiology Laboratory at College of
Veterinary Medicine for microbiological analysis.
Isolation and identification of S. aureus
The whole chicken was transferred to a sterile plastic bag then 400 ml of buffer peptone
water (BPW) was added to the bag. The carcass was rinsed and washed thoroughly for about 2
minutes. For isolation, 10 ml of chicken rinse were collected aseptically and mixed with 90 ml of
BPW. The broth was then incubated for 24 h at 37°C. A loop of the broth culture was streaked
onto the mannitol salt agar (MSA) and then incubated aerobically for 18-24 h at 37°C. S. aureus
colonies were firstly examined based on colonial morphology. The suspected S. aureus colonies
were then selected and streaked onto MSA to get pure colonies of S. aureus. Gram-staining and
catalase test were then applied for colonies that have a typical morphological feature. Gram and
catalase positive isolates were further confirmed for S. aureus biochemically using coagulase test
and also using species- specific primer for PCR.
Molecular methods
Ttotal DNA extraction
106
Bas.J.Vet.Res.Vol.19, No.2, 2020.
DNA was extracted from S. aureus isolates according to (12). Shortly, DNA was prepared
by resuspending 2-3 colonies in 100 μl of deionized autoclaved water and mixed very well.
Bacterial suspensions were boiled in a heat block for 20 min.The suspension was then
centrifuged at 10,000 xg for 1 min. The supernatant was collected to new eppendorf tubes and
then used as the DNA template for subsequent tests. DNA quality and concentrations were
assessed using NanoDrop 2000C spectrophotometer (Theremo Scientific). The ratio 260/280 nm
was in the range of 1.55 to 2.3 for all DNA samples used. The DNA samples were stored at -
20°C for further analysis.
PCR technique
Details of the nucleotide sequences of the primes used for PCR amplification are
provided in Table (1). Approximate gene and primer localizations, based on positions within
staphylococcus genomes can be seen in (13).
Table 1: Nucleotide sequences of primers used in this study
Primer name Sequence (5'—3΄) Annealing
temperature
references
nuc gene
F:AGCGATTGATGGTGATACGG
R:ATACGCTAAGCCACGTCCAT
55°C 14
PSMmec F:CGAAAGCCTGAATGCAAGTCT
R:GGATTTCACTGGTGTTATTACAAGC
70°C 13
XylR(R) to
PSMmec(F)
F:CGAAAGCCTGAATGCAAGTCT
R:AAGCGTCATCTTCTCATTTAGTTGA
55°C 13
PSMmec(R) to
mecR(F)
F: CCAGAAAGTAAACAACGATATTCACC
R:GGATTTCACTGGTGTTATTACAAGC
55°C 13
mecA
F: GTAGAAATGACTGAA CGTCCGATAA
R: CCAATTCCACATTGTTTCGGTCTAA
55°C 15
107
Bas.J.Vet.Res.Vol.19, No.2, 2020.
Current study all PCR reactions were achieved in (0.2 ml) PCR tubes, crystal hot start
master mixes 2x was used for this PCR (Jena Bioscience, Germany).
A total of 20 μl reaction volumes were prepared according to the manufacturer’s
instructions. Shortly, each reaction involved the following components: 10 μl of master mix
(2X), 1.5 μl of each forward and reverse primer (10pmol/μl), and template of DNA (~ 2 μl)
according to the concentration (50ng/μl) and dH2O was added to be completed to 20 μl. PCR
amplification was carried out in a PCR System 9700 Thermocycler (Applied Biosystems).All the
isolates used in this study were further been confirmed using thermo-stable nuclease gene (nuc)
in detection of S. aureus (14).
PCR primers used in this study shows in (Table1). First PCR Reaction conditions of
PSMmec primer included an initial denaturation (2 min at 96°C) followed by 35 cycles (20 sec at
96°C, 20 sec at 70°C and 20 sec at 72°C). A second PCR covered the region from xylR to
PSMmec (PSMmec and xylR), while the third one spanned the region from (PSMmec to mecR).
Both second, third and MecA PCR reactions included denaturation for (2 min at 96°C) followed
by 35 cycles (20 sec at 96°C, 20 sec at 55°C and 70 sec at 72°C), the details can be seen in Table
2 (16).
108
Bas.J.Vet.Res.Vol.19, No.2, 2020.
Table2: The PCR primer condition of all the genes used in this study
Gel electrophoresis technique:
PCR products were established by electrophoresis in a 1.5% (w/v) agarose gel using 1X
TAE buffer with nucleic acid dye Syber® Safe (Invitrogen). Seven microliters of each PCR
product were loaded into each well. The size of the PCR products was showed by loading 7 μl of
100bp DNA ladder (Jena Bioscience, Germany). The fragment sizes were then visualised and
photographed under UV light figure (1).
RESULTS AND DISCUSSION
From 200 (100 local and 100 imported chicken) whole chicken samples were examined
for the present of S. aureus, 108 isolates were found to be positive for staphylococcus by culture
method (80 from imported frozen chicken and 28 from local chicken), however, only 68 from
imported and 22 from local chicken were noticed to be S. aureus species depending on the
coagulate test. Moreover, these samples were further been confirmed using S. aureus specific
Primer
Name
PCR conditions
Initial
Denaturation Denaturation Annealing
Temperature Extension Final
Extension
nuc gene 2 min at
94°C
30 sec at
96°C 55°C 2min at 72°C 72 °C
10 min
PSMmec
2 min at
96°C
20 sec at
96°C
70°C
20 sec at 72°C
72 °C
10 min
XylR(R) to
PSMmec(F) 55°C
PSMmec(R)
to mecR(F)
mecA 10 min at
94°C 45 s at 94°C 55°C 72°C for
75 s
72 °C
10 min
Repeated for 35 cycles
109
Bas.J.Vet.Res.Vol.19, No.2, 2020.
gene (nuc gene) by conventional PCR, from these only 57 and 18 were indicated as S. aureus in
both imported and local chicken, respectively, these results have been published in a separate
study (14), the same isolates have been used to implement this study.Identification of the
Staphylococcus cassette chromosome mec (SCCmec) of this study isolates will mainly depend
on the previous studies outcomes (3,13,16,17), inorder to recognise the possible classification of
MGEs of S. aureus isolated in this study. In present study, a PCR reaction that covering the area
from xylR to PSMmec indicate that, out of 57 imported isolates only 31 isolates were found to be
positive for this region, and 2 out of 18 isolates from the local chickens were give positive results
for this locus.In 32 isolates PSMmec, were found negative (20 from imported and 12 from local)
isolates, from these xylR was also absent. Results of the third PCR mecR/PSMmec were only
found in 15 imported isolates, in addition to the present of mecA, PSMmec/xylR and PSMmec
(Table 3), while none of the local isolates were give positive results for the third PCR
(mecR/PSMmec), (Table 3). The PCR results are shown in Figure (1)
Figure 1: PCR assay for detection of PSMmec gene (A), methicillin resistance gene (mecA)
(B), PSMmec/xylR region (C) and mecR/PSMmec region (D) in S. aureus isolates from
imported and local chicken. Lane (1) 100bp DNA ladder (Jenabiosciences, Germany).
110
Bas.J.Vet.Res.Vol.19, No.2, 2020.
Table3: Description of PCR results of PSM complex
*According to the genes tested the S. aureus isolated for imported chickens have SCC elements SCCMECI, II (2A)
and IID, while the local chickens have just SCCmec IID. This classification is done depending on the study results
of (3,6,7) , however, this must be confirmed by sequencing of SCCs in the future study.
On the basis of available MRSA genome sequences, the PSMmec gene is found mostly
within SCCmec determinants of types II and III (18). It has been noticed that CC12-MRSA,
WA-MRSA-59 harbored SCCmec elements containing mecR but missing xylR. However, this
study revealed that some of the imported chickens isolates may carries SCCmec type (IIA) and
IID elements having xylR but lacking mecR this classification depends on the outcome of
(3,13,16).
It was found that the PSMmec is associated with mecI and/or xylR, in another word it can
be found in the isolates harboring Classification of Staphylococcal Cassette Chromosome mec
(SCCmec) types II, II-A, II-B, II-D, III, and VIII or types II-A/B and III as irregular elements
related to SCCmec. However, PSMmec was not limited just in S. aureus. The other
staphylococcus species such as S. pseudintermedius, S. epidermidis, S. hominis S. fleuretti, S.
saprophyticus, S. vitulinus and S. simulansmay may also carry PSMmec. Present of this gene is
not only restricted in one host species, it was noticed in different isolates from different host like
in cattle, turkeys, pigs, goats, sheep, cattle, cats and human (5,7,13).
Species
of bacteria
Host
and
origin
No. of
isolates
tested
PSMmec
PSMmec
/xylR
mecR /
PSMmec
mecA Expected SCC*
S. aureus Imported
chicken
20 - - - +(13/20)
S. aureus Imported
chicken
19 +(17/19) +(15/19) +(15/19) +(16/19)
SCCmec
I, II(2A)
S. aureus Imported
chicken
18 +(17/18) +(16/18) - +(17/18) SCCmec (I, IID)
S. aureus Local
chicken
12 - - - +(6/12)
S. aureus Local
chicken
6 +(2/6) +(2/6) - +(2/6) SCCmec(IID)
111
Bas.J.Vet.Res.Vol.19, No.2, 2020.
The PSMmec was not found in SCCmec types I, IIC, IIE, IV, V or XI and in SCC
elements missing the mec complex (13,16). Accordingly, this study also revealed that 13 isolates
of S. aureus from imported chicken were just carries mecA, this is suggests that these isolates
may carry either SCCmec type I or II. Some S. aureus isolates of the current study were missing
PSMmec, this is an indication of either absent of SCCmec elements, or carrying SCCmec types
I, IIC, IIE, IV and V as stated by (13,16). Virulence factors association with mobile genetic
elements (MGEs) deliberating drug resistance detected in E. coli (2,19) and enterococci (20),
however, the connection of PSMmec to SCCmec in staphylococci, is rather unique (21). The α-
type PSM peptide has a cytolytic and proinflammatory action and plays an important role in
MRSA infection. In a study conducted by (22), found that 7.6% of all MRSA strains carried the
psm gene from the isolates collected from blood, sputum, wound, and trachea. Joo and
coworkers (2011) (23) state that PSMs have cytolytic activities on the neutrophils, red blood
cells, and white blood cells and impact on pathogenesis of bacteremia, skin and soft tissue
infections. According to their surfactant like properties, PSMs have also been suggested to
influence biofilm maturation and detachment(21–24).
The presence of PSMmec in MRSA strains can be a key factor for the pandemic spread
and abundance success of SCCmec elements. Therefore, this study suggest that the S. aureus
isolated from imported chicken may be more virulent than the isolates from local chicken due the
present of PSMmec complex which were from types I, II(2A) and IID as listed in Table (3).
Isolates resistance to methicillin with PSM contribute to staphylococcal virulence.
Accordingly, this study shows that this pattern is more obvious in imported chicken isolates
rather than local chickens. The role of methicillin resistance groups in the pathogenicity of
staphylococcal has also studied by (3), they identified that the majority of serious antibiotics and
virulence resistance elements may be associated in staphylococcal MGEs. Our study shows that
in similarity to the previous belief, S. aureus can handle both resistance and virulence factors on
MGEs, consequently, this combination will help to transfer of two important factors for causing
human disease in one genetic episode.
112
Bas.J.Vet.Res.Vol.19, No.2, 2020.
المعزولة من الدجاج المحلی S. aureus الضراوة المحتملة لبکتریا المکورات العنقودیة الذھبیة
فی محاظة دھوک، أقلیم Phenol Soluble Modulin (PSMmec) والمستورد بالاعتماد على
کوردستان العراق
نیجرفان مجید غفار ١
١کلیة الطب البیطری، مرکزدھوک للابحاث، جامعة دھوک،أقلیم کوردستان العراق
الخلاصة
أحد أھم البکتریا المسببة للتسمم الغذائی لدى الانسان Staphylococcus aureus تعد المکورات العنقودیة الذھبیة
تلعب دورا مھما فی الامراضیة، والتی تتضمن تلف انسجة المضیف S. aureus والحیوان. الذیفانات التی تنتجھا
والذی ،Phenol Soluble Modulin (PSM) والتأثیرعلى الاستجابة المناعیة. أحد ھذه الذیفانات ھو ذیفان بروتینی یدعى
Mobile لھ القدرة على اختراق الجھاز المناعی ویعتبر أیضا من الذیفانات المحللة للخلایا. غالبا العوامل الجینیة المتنقلة
للمکورات العنقودیة الذھبیة والتی تحتوی على مورثات مقاومة لمضادات الحیویة لاتحتوی على genetic elements
والتی تم تشخیصھ فی المکورات العنقودیة الذھبیة المقاومة للمیثیسلین والتی تشّفر للعامل (PSM) مورثات الفوعة ماعدا
تم فحص ٢٠٠ عینة لحوم دواجن کاملة بواقع .(SCC) Staphylococcal Cassette Chromosome الجینی المتنقل
١٠٠ عینة من الدجاج المحلی و ١٠٠ عینة من الدجاج المستوردة. تم زراعة العینات على أوساط المانیتول الملحی لیتم تأکید
(nuc) حیث العزلات الموجبة لمورث ،PCR شکل المستعمرات وأجراء فحص صبغة غرام ، فحص الکتالیز وباسخدام تقنیة
تم الاعتماد علیھا لتکملة ھذه الدراسة .ھذه الدراسة تھدف إلى تقییم الضراوة المحتملة للمکورات العنقودیة الذھبیة المعزولة من
(mecR, والتی تغطی الجینات PSMmec-complex الدجاج المحلی والمستورد إعتمادا على تفاعل البلمرة المتسلسل ل
أظھرت ھذه الدراسة بأنھ ٤٦ عزلة من أصل ٥٧ عزلة من المکورات . mecA بالاضافة إلى المورث xylR and psm)
اما .PSMmec وأن ٢٨ من ھذه العزلات تحمل المورث ، mecA العنقودیة الذھبیة فی الدجاج المستورد تحمل المورث
بالنسبة للمکورات العنقودیة الذھبیة المعزولة من الدجاج المحلی، أظھرت ھذه الدراسة أنھ فقط عزلتین من ضمن 18 عزلة
المعزولة S. aureus الذی إجراءه على عزلات PSM-complex معا. تبعا لاختبار PSMmec و mecA تحمل المورثات
بینماعزلات .IID و SCCmec I, II (2A) من نوع SCC من الدجاج المستورد، تبین ان ھذه العزلات قد تحمل عوامل
من الممکن PSM العزلات المقاومھ للمیثیسلین والتی تحمل المورث .SCCmecIID الدجاج المحلی کانت تحمل فقط النوع
أن تلعب دورا مھما فی ضراوة المکورات العنقودیة. النتائج المتحصلة فی ھذه الدراسة تقترح أنھ العزلات فی الدجاج المستورد
وتقنیة سلسلة االدنا SCC أکثرضراوة من الدجاج المحلی. ھذه النتائج قد تکون اکثر تأکیدا إذا ما استخدم تضخیم عوامل
لتحدید الخارطة الجینیة لھذه المناطق. DNA sequencing
113
Bas.J.Vet.Res.Vol.19, No.2, 2020.
REFERENCES
1. Wang R, Braughton KR, Kretschmer D, Bach THL, Queck SY, Li M, et al.( 2007).
Identification of novel cytolytic peptides as key virulence determinants for
community-associated MRSA. Nat Med. 13(12):1510–4.
2. Ito T, Okuma K, Ma XX, Yuzawa H and Hiramatsu K(2003). Insights on antibiotic
resistance of Staphylococcus aureus from its whole genome: Genomic island SCC.
Drug Resist Updat. 6(1):41–52.
3. Queck SY, Khan BA, Wang R, Bach THL, Kretschmer D, Chen L, et al(2009). Mobile
genetic element-encoded cytolysin connects virulence to methicillin resistance in
MRSA. PLoS Pathog. 5(7):1–12.
4. Kaito C, Omae Y, Matsumoto Y, Nagata M, Yamaguchi H, Aoto T, et al.( 2008). A
novel gene, fudoh, in the SCCmec region suppresses the colony spreading ability and
virulence of Staphylococcus aureus. PLoS One. 3(12).
5. Ito T, Katayama Y, Asada K, Mori N, Tsutsumimoto K, Tiensasitorn C, et al.( 2001).
Structural Comparison of Three Types of Staphylococcal Cassette Chromosome.
Society. 45(5):1323–36.
6. Shore AC, Deasy EC, Slickers P, Brennan G, O’Connell B, Monecke S, et al.(2011).
Detection of staphylococcal cassette chromosome mec type XI carrying highly
divergent mecA, mecI, mecR1, blaZ, and ccr genes in human clinical isolates of clonal
complex 130 methicillin-resistant Staphylococcus aureus. Antimicrob Agents
Chemother. 55(8):3765–73.
7. Ito T, Hiramatsu K, Oliveira DC, De Lencastre H, Zhang K, Westh H, et al. (2009).
Classification of staphylococcal cassette chromosome mec (SCCmec): Guidelines for
reporting novel SCCmec elements. Antimicrob Agents Chemother. 53(12):4961–7.
8. Dinges MM, Orwin PM and Schlievert PM (2000). Exotoxins of Staphylococcus aureus.
Clin Microbiol Rev. 13(1):16-34.
9. Foster TJ(2005). Immune evasion by staphylococci. Nat Rev Microbiol. 3(12):948–58.
10. Otto M (2014). Laporan Praktikum Isolasi Dna Dan Teknik Pcr. Nama Juwita Rika
Nailuvar Sinaga. 32–7.
114
Bas.J.Vet.Res.Vol.19, No.2, 2020.
11. Gray GS and Kehoe M (1984). Primary sequence of the α-toxin gene from
Staphylococcus aureus Wood 46. Infect Immun. 46(2):615–8.
12. Aranda KRS, Fagundes-Neto U and Scaletsky ICA(2004). Evaluation of multiplex PCRs
for diagnosis of infection with diarrheagenic Escherichia coli and Shigella spp. J Clin
Microbiol. 42(12):5849–53.
13. Monecke S, Engelmann I, Archambault M, Coleman DC, Coombs GW, Cortez de
Jäckel S, et al.( 2012). Distribution of SCCmec-associated phenol-soluble modulin in
staphylococci. Mol Cell Probes. 26(2):99–103.
14. Abdulrahman RF(2020). Detection of Staphylococcus aureus from Local and Imported
chicken in Duhok Province/ Kurdistan Region of Iraq Using Conventional and
Molecular Methods. BasJVetRes. 2(19):accepted.
15. McClure JA, Conly JM, Lau V, Elsayed S, Louie T, Hutchins W, et al. (2006). Novel
multiplex PCR assay for detection of the staphylococcal virulence marker Panton-
Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible
from -resistant staphylococci. J Clin Microbiol. 44(3):1141–4.
16. Monecke S, Skakni L, Hasan R, Ruppelt A, Ghazal SS, Hakawi A, et al.( 2012).
Characterisation of MRSA strains isolated from patients in a hospital in Riyadh,
Kingdom of Saudi Arabia. BMC Microbiol. 12(1).
17. Novick RP, Schlievert Pand Ruzin A.( 2001). Pathogenicity and resistance islands of
staphylococci. Microbes Infect. 3(7):585–94.
18. Berube BJ, Sampedro GR, Otto M and Wardenburg JB.( 2014). The psmα locus
regulates production of Staphylococcus aureus alpha-toxin during infection. Infect Immun.
82(8):3350–8.
19. Raad I, Alrahwan A and Rolston K.( 1998). Staphylococcus epidermidis : Emerging
Resistance and Need for Alternative Agents . Clin Infect Dis. 26(5):1182–7.
20. Mehlin C, Headley CM and Klebanoff SJ.( 1999). An inflammatory polypeptide complex
from Staphylococcus epidermidis: Isolation and characterization. J Exp Med.
189(6):907–17.
21. Lowy F. (1998). The chromosome, as well as the extrachromosomal el- ements. 6 These
genes are transferred between staphy- lococcal strains, species, or other gram-positive
bacte- rial species through the extrachromosomal elements. 7. N Engl J Med. 339:520–
115
Bas.J.Vet.Res.Vol.19, No.2, 2020.
32.
22. Eshaghi M, Bibalan MH, Pournajaf A, Gholami M and Talebi M (2017). Detection of
New Virulence Genes in mecA-positive Staphylococcus aureus Isolated from Clinical
Samples: The First Report from Iran. Infect Dis Clin Pract. 25(6):310–3.
23. Joo HS, Cheung GYC and Otto M. (2011). Antimicrobial activity of communityassociated
methicillin-resistant Staphylococcus aureus is caused by phenol-soluble
modulin derivatives. J Biol Chem. 286(11):8933–40.
24. Klingenberg C, Rønnestad A, Anderson AS, Abrahamsen TG, Zorman J, Villaruz A,
et al.( 2007). Persistent strains of coagulase-negative staphylococci in a neonatal
intensive care unit: Virulence factors and invasiveness. Clin Microbiol Infect.
13(11):1100–11.

1. Wang R, Braughton KR, Kretschmer D, Bach THL, Queck SY, Li M, et al.( 2007).
Identification of novel cytolytic peptides as key virulence determinants for
community-associated MRSA. Nat Med. 13(12):1510–4.
2. Ito T, Okuma K, Ma XX, Yuzawa H and Hiramatsu K(2003). Insights on antibiotic
resistance of Staphylococcus aureus from its whole genome: Genomic island SCC.
Drug Resist Updat. 6(1):41–52.
3. Queck SY, Khan BA, Wang R, Bach THL, Kretschmer D, Chen L, et al(2009). Mobile
genetic element-encoded cytolysin connects virulence to methicillin resistance in
MRSA. PLoS Pathog. 5(7):1–12.
4. Kaito C, Omae Y, Matsumoto Y, Nagata M, Yamaguchi H, Aoto T, et al.( 2008). A
novel gene, fudoh, in the SCCmec region suppresses the colony spreading ability and
virulence of Staphylococcus aureus. PLoS One. 3(12).
5. Ito T, Katayama Y, Asada K, Mori N, Tsutsumimoto K, Tiensasitorn C, et al.( 2001).
Structural Comparison of Three Types of Staphylococcal Cassette Chromosome.
Society. 45(5):1323–36.
6. Shore AC, Deasy EC, Slickers P, Brennan G, O’Connell B, Monecke S, et al.(2011).
Detection of staphylococcal cassette chromosome mec type XI carrying highly
divergent mecA, mecI, mecR1, blaZ, and ccr genes in human clinical isolates of clonal
complex 130 methicillin-resistant Staphylococcus aureus. Antimicrob Agents
Chemother. 55(8):3765–73.
7. Ito T, Hiramatsu K, Oliveira DC, De Lencastre H, Zhang K, Westh H, et al. (2009).
Classification of staphylococcal cassette chromosome mec (SCCmec): Guidelines for
reporting novel SCCmec elements. Antimicrob Agents Chemother. 53(12):4961–7.
8. Dinges MM, Orwin PM and Schlievert PM (2000). Exotoxins of Staphylococcus aureus.
Clin Microbiol Rev. 13(1):16-34.
9. Foster TJ(2005). Immune evasion by staphylococci. Nat Rev Microbiol. 3(12):948–58.
10. Otto M (2014). Laporan Praktikum Isolasi Dna Dan Teknik Pcr. Nama Juwita Rika
Nailuvar Sinaga. 32–7.
114
Bas.J.Vet.Res.Vol.19, No.2, 2020.
11. Gray GS and Kehoe M (1984). Primary sequence of the α-toxin gene from
Staphylococcus aureus Wood 46. Infect Immun. 46(2):615–8.
12. Aranda KRS, Fagundes-Neto U and Scaletsky ICA(2004). Evaluation of multiplex PCRs
for diagnosis of infection with diarrheagenic Escherichia coli and Shigella spp. J Clin
Microbiol. 42(12):5849–53.
13. Monecke S, Engelmann I, Archambault M, Coleman DC, Coombs GW, Cortez de
Jäckel S, et al.( 2012). Distribution of SCCmec-associated phenol-soluble modulin in
staphylococci. Mol Cell Probes. 26(2):99–103.
14. Abdulrahman RF(2020). Detection of Staphylococcus aureus from Local and Imported
chicken in Duhok Province/ Kurdistan Region of Iraq Using Conventional and
Molecular Methods. BasJVetRes. 2(19):accepted.
15. McClure JA, Conly JM, Lau V, Elsayed S, Louie T, Hutchins W, et al. (2006). Novel
multiplex PCR assay for detection of the staphylococcal virulence marker Panton-
Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible
from -resistant staphylococci. J Clin Microbiol. 44(3):1141–4.
16. Monecke S, Skakni L, Hasan R, Ruppelt A, Ghazal SS, Hakawi A, et al.( 2012).
Characterisation of MRSA strains isolated from patients in a hospital in Riyadh,
Kingdom of Saudi Arabia. BMC Microbiol. 12(1).
17. Novick RP, Schlievert Pand Ruzin A.( 2001). Pathogenicity and resistance islands of
staphylococci. Microbes Infect. 3(7):585–94.
18. Berube BJ, Sampedro GR, Otto M and Wardenburg JB.( 2014). The psmα locus
regulates production of Staphylococcus aureus alpha-toxin during infection. Infect Immun.
82(8):3350–8.
19. Raad I, Alrahwan A and Rolston K.( 1998). Staphylococcus epidermidis : Emerging
Resistance and Need for Alternative Agents . Clin Infect Dis. 26(5):1182–7.
20. Mehlin C, Headley CM and Klebanoff SJ.( 1999). An inflammatory polypeptide complex
from Staphylococcus epidermidis: Isolation and characterization. J Exp Med.
189(6):907–17.
21. Lowy F. (1998). The chromosome, as well as the extrachromosomal el- ements. 6 These
genes are transferred between staphy- lococcal strains, species, or other gram-positive
bacte- rial species through the extrachromosomal elements. 7. N Engl J Med. 339:520–
115
Bas.J.Vet.Res.Vol.19, No.2, 2020.
32.
22. Eshaghi M, Bibalan MH, Pournajaf A, Gholami M and Talebi M (2017). Detection of
New Virulence Genes in mecA-positive Staphylococcus aureus Isolated from Clinical
Samples: The First Report from Iran. Infect Dis Clin Pract. 25(6):310–3.
23. Joo HS, Cheung GYC and Otto M. (2011). Antimicrobial activity of communityassociated
methicillin-resistant Staphylococcus aureus is caused by phenol-soluble
modulin derivatives. J Biol Chem. 286(11):8933–40.
24. Klingenberg C, Rønnestad A, Anderson AS, Abrahamsen TG, Zorman J, Villaruz A,
et al.( 2007). Persistent strains of coagulase-negative staphylococci in a neonatal
intensive care unit: Virulence factors and invasiveness. Clin Microbiol Infect.
13(11):1100–11.
السنة 19، العدد 2
الخريف 2020
الصفحة 103-115

  • تاريخ الاستلام 04 حزيران / يونيو 2020
  • تاريخ التعديل 13 حزيران / يونيو 2020
  • تاريخ القبول 14 حزيران / يونيو 2020
  • تاريخ النشر 14 حزيران / يونيو 2020