تقييم وجود جينات سموم الشيغا في عزلات الإشريكية القولونية من عينات براز الدجاج

نوع المقالة : بحث

المؤلف

فرع الأحیاء الدقیقة، كلیة الطب البیطري، جامعة البصرة، البصرة، العراق

الملخص
صممت الدراسة الحالية لعزل وتشخيص بكتيريا الإشريكية القولونية من فضلات الدجاج واستكشاف وجود بكتيريا الإشريكية القولونية المنتجة لسموم الشيجا (STEC) في الدجاج في محافظة البصرة للفترة الممتدة من 18 تشرين الأول 2023 إلى 13 كانون الثاني 2024. من بين 204 عينة، كانت 102 عينة من دجاج الفناء الخلفي، و48 عينة من حقول الدواجن، و54 عينة من محلات الدجاج، وكانت 109 (53.4%) إيجابية بالنسبة للإشريكية القولونية باستخدام التقنيات الميكروبيولوجية التقليدية. تم استخدام تفاعل البوليميراز المتسلسل لتأكيد العزلات التي استهدفت جين uidA للإشريكية القولونية، أشارت نتائج هذه التقنية إلى أن 84 (77%) من العزلات كانت من الإشريكية القولونية من العينات التي تم اختبارها. تم تعريض جميع العزلات لتفاعل البلمرة المتسلسل للكشف عن جينات ذيفان الشيجا .(stx1 &stx2) لم تظهر أي من عزلات الإشريكية القولونية المدروسة وجود جينات stx1 أو .stx2
أشارت هذه النتائج إلى أن عزلات الإشريكية القولونية من الدجاج كانت سلبية لجينات ذيفان الشيجا (stx1، stx2).

الكلمات الرئيسة

Crossmark

Introduction

The bacteria known as Escherichia coli are Gram-negative commensal bacteria that have a rod-like morphology and a flagellum, and they are members of the Enterobacteriaceae family ( 1 ). E. coli is a prevalent microbial flora of the human and poultry digestive tracts and other animals, though it can potentially become pathogenic for both. However, many E. coli isolates are not harmful. They are considered a sign of fecal contamination in food ( 2 ). It is the cause of several disorders in chickens, including coli granuloma, swollen head syndrome, cellulitis, omphalitis, and yolk sac infection ( 3 ). Extraintestinal pathogenic Escherichia coli (ExPEC) and intestinal pathogenic Escherichia coli (IPEC) are the two main categories into which pathogenic E. coli can be classified ( 4 ). The diverse collection of enteric pathogens known as Shiga toxin-producing E. coli (STEC) is accountable for both widespread outbreaks and many sporadic infections across the globe ( 5 ). The basic virulence factors of these strains are Shiga toxins (Stx1 and Stx2) ( 6 ). E. coli, which produces Shiga toxins (STEC), is one of the most significant pathogens spread through food. These strains not only induce food poisoning but also serious illnesses such as hemolytic uremic syndrome, bleeding colitis, and diarrhea ( 7 ). STEC has been proven to be a zoonotic root with various groups of pathogenic E. coli in cattle from among ruminants, serving as the major reservoir for human diseases ( 8 ). An intensifying number of previous studies from different countries have listed low rates of prevalence of Shiga toxins in chicken (4%) in Northwest Iran ( 9 ). The rates of STEC in chicken carcasses, cloacae, chicken burgers, and giblets were confirmed to be 3.3%, 0.1%, 2.3%, and 10.3%, respectively, in Argentina ( 10 ), 1% in Turkey ( 11 ), and 0.5% in southern Vietnam ( 12 ). The current study aims to determine if Escherichia coli isolates from chicken fecal samples in the province of Basrah have Shiga toxin genes.

Materials And Methods

Samples collection: The samples used in this study were obtained from fresh droppings and cloacal swabs of chickens gathered from various parts of the Basrah region. There were 204 dropping and cloacal swabs from backyard chickens, poultry fields, and chicken shops from 18 October 2023 to 13 January 2024, (Table ,1).

Source of sample Type of sample Total No.
Cloacal swab Droppings swab
Backyard chicken 67 35 102
Poultry fields 48 0 48
Chicken shop (markets) 38 16 54
Total 153 51 204
Table (1).Number and sources of samples used in this study

Microbiological methods: The samples were gathered by sterile swabs and transported directly to the Central Research Unit in the College of Veterinary Medicine by icebox. The lab cultivated the samples in peptone water for twenty-four hours at 37°C ( 13 ). After incubation, the samples were subcultured on MacConkey agar overnight at 37C. From the pre-incubated samples, 3 pink colonies were chosen randomly from MacConkey agar and transferred to eosin methylene blue (EMB) agar overnight at 37⸰C. The colonies were watched for metallic sheen appearance ( 14). The suspected E. coli colonies were submitted to various biochemical tests, including Gram stain ( 15), Simmons' Citrate ( 16), Indole production, Methyl red, and Voges–Proskauer (IMVIC) tests ( 17).

Molecular study: The suspected colonies were confirmed by being subjected to PCR to detect the uid A gene.

DNA Extraction: From nutrient agar, five E. coli colonies were inoculated into brain heart infusion (BHI) broth and incubated overnight at 37°C. The genomic bacterial DNA was extracted using the boiling method according to ( 18 ).

Molecular confirmation of E. coli: The uidA gene was amplified using the PCR technique to confirm the potential E. coli isolates discovered by conventional microbiological methods and

experimental conditions described by ( 19), using PCR technique, the amplicon size was 203 bp.

Detection of Shiga toxins genes (stx1 and stx2): Employing the primers listed in this work, the virulence genes stx1 and stx2 were examined by the PCR technique to identify E. coli pathotypes. The primers were designed using the GenScript Tool, as shown in Table (2). The volumes of mixtures used for amplification of virulence genes stx1 and stx2 were prepared in a total of 25 μl PCR reaction, 7.5μL of nuclease-free water, 3μL of DNA template, 2μL of each primer, and 12.5 μL of the master mix (Promega, USA) were used.

Primer Primer sequences (5-3) Length Product size GenBank accession no Reference Manufacturer
Stx 1 F:5′-CTGTGGCAAGAGCGATGTTA-3′ 20bp 196 bp NC_002695.2 This study Promega / USA R:5′- CTCAACCTTCCCCAGTTCAA -3′
Stx 2 F:5′- GTTCCGGAATGCAAATCAGT-3′ 20bp 206 bp BA000007.3 This study Promega / USA R:5′- CGGCGTCATCGTATACACAG -3′
Table (2).The primer sequences for detecting Stx1 and Stx2.

Thermal cycling for stx1 was conducted using the initial denaturation of 94 °C for 3 minutes, followed by 30 amplification cycles of 45 seconds at 94 °C, 45 seconds at 54 °C, and 45 seconds at 72 °C. This step was followed by a final extension step of 5min at 72 °C. As for stx2, the condition PCR consisted of 95 °C for 4 min, followed by 30 cycles of 95 °C for 45sec, 53 °C for 1min, and 72 °C for 1min, with a final extension step of 72 °C for 5min.

Results

Identification of E. coli isolates

Of 204 dropping and cloacal swabs from chicken samples, 109 (53.4 %) samples were positive for Escherichia coli based on biochemical and morphological features. The isolates displayed short-rod Gram-negative bacteria, green metallic sheen colonies on EMB agar, pink colonies on MacConkey agar, and were positive for indole and methyl red: hence, the isolates were negative for Voges-Proskauer and Citrate utilization tests (Figure 1).

Figure (1).Morphological characteristics of isolates A. E. coli on EMB agar medium. B. Microscopical appearance of E. coli, short-rod Gram-negative bacteria. C. Growth on MacConkey agar.

Molecular detection of uidA gene

The uidA gene was found using the PCR method, confirming the suspected isolates as E. coli. The product's size was 203 bp. Of 109 suspected isolates by using conventional biochemical tests, 84(77%) were confirmed as E. coli (Table 3), (Figures 2 and 3).

Source Total No. conventional microbiological techniques Detection by uidA
No. % No. %
Backyard chicken 102 39 38.2 34 87.1
Poultry fields 48 44 91.6 36 81.8
Chicken shop (Market) 54 26 48.1 14 53.8
Total 204 109 53.4 84 77
Table (3).Results of E. coli identification using conventional microbiological techniques and PCR

Figure (2).Total number of samples, suspected and confirmed isolates according to sample source.

Figure (3).Product of PCR of uidA gene on 1.5% agarose gel, where (L) 100bp DNA ladder.

Molecular detection of stx1 and stx2

The results are shown in Figures (4 and 5) of the PCR analysis of E. coli isolates for the stx1 and stx2 genes, which are virulence genes in STEC. he results show that all isolated E. coli isolates lack the stx1 and stx2 genes, with a positive control for stx1 and stx2 provided by ( 20).

Figure (4).The stx1gene electropherogram. Lane (1) included a positive control sample, whereas lanes 2–6 had negative samples.

Figure (5).The stx2 gene electropherogram. Lane 1 included a positive control sample, while 2–5 were negative.

Discussion

Escherichia coli is the main infectious pathogen in poultry ( 21). Shiga toxins (Stx), a class of cytotoxins made up of two primary kinds (Stx1 and Stx2), are produced by STEC strains ( 22). However, cattle and sheep are expected to be the natural reservoirs of these microorganisms, as they are the primary sources from which the STEC strains have been obtained..

The features and existence of pathogenic E. coli in healthy chickens may have implications for the health of animals and humans. This study aimed to evaluate the E. coli isolates from the feces of local chickens to see if they carried Shiga toxin. Out of all the samples, the net isolation rate of Escherichia coli was 53.4%. This result was found to be lower than 80% by ( 25 ). On the other hand, this rate is considered higher than 36% by ( 7).

The present study revealed the absence of stx1 and stx2 in 84 Escherichia coli isolates tested by the PCR technique in Basrah province. This is consistent with the observations of ( 26), who also found that fecal samples from 500 chickens had no STEC, and ( 27 ), who reported no STEC in 199 chicken fecal samples. This is in contrast to the results of ( 28), who detected STEC genes in 7.3% of 422 chicken samples and 12.24% of isolates positive for both stx1 and stx2 genes ( 29 ). The main sources of Shiga toxin-producing E. coli are not chickens, but ruminants, particularly cattle and sheep, are more commonly associated with STEC, according to ( 19 ).

Conclusion

In the present study, genes (stx1 and stx2) were not found in any E. coli isolates obtained from chicken fecal samples from various sources in the Basrah province.

Conflicts of interest

The authors declare that there is no conflict of interest.

Ethical Clearance

This work is approved by The Research Ethical Committee.

References

  1. 1.Runa, J. A., Lijon, M. B., & Rahman, M. A. (2018). Detection of multidrug resistant and Shiga toxin producing Escherichia coli (STEC) from apparently healthy broilers in Jessore, Bangladesh.  Frontiers in Environmental Microbiology, 4(1), 16-21.
  2. Daga, A. P., Koga, V. L., Soncini, J. G. M., de Matos, C. M., Perugini, M. R. E., Pelisson, M., Sack, R. B. (2011). The discovery of cholera-like enterotoxins produced by Escherichia coli causing secretory diarrhoea in humans. Indian Journal of Medical Research, 133(2), 171-178.
  3. Panth, Y. (2019). Colibacillosis in poultry: A review. Journal of Agriculture and Natural Resources, 2(1), 301–311. https://doi.org/10.3126/janr.v2i1.26094.DOI
  4. Dale, A.P. & Woodford, N. (2015). Extra-intestinal pathogenic Escherichia coli (ExPEC): Disease, carriage and clones. J. Infect. ;71,615–626.
  5. Parsons, B. D., Zelyas, N., Berenger, B. M., & Chui, L. (2016). Detection, Characterization, and Typing of Shiga Toxin-Producing Escherichia coli. Frontiers in Microbiology, 7, 478. https://doi.org/10.3389/fmicb.2016.00478.DOI
  6. Tahamtan, Y., Hayati, M., & Namavari, M. (2010). Prevalence and distribution of the stx, stx genes in Shiga toxin producing E. coli (STEC) isolates from cattle. Iranian journal of microbiology, 2(1), 8–13.
  7. Zarei, O., Shokoohizadeh, L., Hossainpour, H., & Alikhani, M. Y. (2021). The Prevalence of Shiga Toxin-Producing Escherichia coli and Enteropathogenic Escherichia coli Isolated from Raw Chicken Meat Samples. International Journal of Microbiology, 2021, 3333240. https://doi.org/10.1155/2021/3333240.DOI
  8. Daoud, J. R., Mohamed, K., Nasef, S. A., & Ahmed, R. Y. (2016). Detection of Shiga toxin produced by Escherichia coli in poultry and meat in Luxor city using multiplex PCR. Benha Veterinary Medical Journal, 31(2), 40-44.
  9. Tabatabaei, M., Mokarizadeh, A., & Foad-Marashi, N. (2011). Detection and Molecular Characterization of Sorbitol Negative Shiga Toxigenic Escherichia Coli in Chicken from Northwest of Iran. Veterinary Research Forum, 2(3), 183-188.
  10. Alonso, M. Z., Lucchesi, P. M. A., Rodríguez, E. M., Parma, A. E., & Padola, N. L. (2012). Enteropathogenic (EPEC) and Shigatoxigenic Escherichia coli (STEC) in broiler chickens and derived products at different retail stores. Food Control, 23(2), 351-355.
  11. Karadal, F., Ertas, N., Hizlisoy, H., Abay, S., & Al, S. (2013). Prevalence of Escherichia coli O157: H7 and their verotoxins and Salmonella spp. in processed Poultry Products. Journal of Food Safety, 33(3), 313-318.
  12. Trung, N. V., Nhung, H. N., Carrique-Mas, J. J., Mai, H. H., Tuyen, H. T., Campbell, J., Nhung, N. T., Van Minh, P., Wagenaar, J. A., Mai, N. T., Hieu, T. Q., Schultsz, C., & Hoa, N. T. (2016). Colonization of Enteroaggregative Escherichia coli and Shiga toxin-producing Escherichia coli in chickens and humans in southern Vietnam. BMC Microbiology, 16(1), 208. https://doi.org/10.1186/s12866-016-0827-z.DOI
  13. Baccus‐Taylor, G. S. H., Falloon, O. C., & Henry, N. (2015). Pressure resistance of cold‐shocked Escherichia coli O157: H7 in ground beef, beef gravy and peptone water. Journal of Applied Microbiology, 118(6), 1521-1529.
  14. Samanta, I., Joardar, S. N., Das, P. K., Das, P., Sar, T. K., Dutta, T. K., Bandyopadhyay, S., Batabyal, S., & Isore, D. P. (2014). Virulence repertoire, characterization, and antibiotic resistance pattern analysis of Escherichia coli isolated from backyard layers and their environment in India. Avian Diseases, 58(1), 39–45. https://doi.org/10.1637/10586-052913-Reg.1.DOI
  15. Atlas, R. M., Parks, L. C., & Brown, A. E. (1995). Laboratory manual of experimental microbiology. Mosby-Year Book. Inc., USA, 25.
  16. Ateba, C. N., & Marumo, B. I. (2014). Isolation of Enterohaemorrhagic Escherichia coli O104 strains from raw meat products in the North West Province, South Africa. J Food Nutr Res, 2(6), 288-93.
  17. Aslani, M. M., & Alikhani, M. Y. (2009). Serotypes of enteropathogenic Escherichia coli isolated from children under 5 years of age.‏ Iran J Public Health. 1;38(3):70-77.
  18. Ribeiro Junior, J. C., Tamanini, R., Soares, B. F., de Oliveira, A. M., de Godoi Silva, F., da Silva, F. F., Augusto, N. A. & Beloti, V. (2016). Efficiency of boiling and four other methods for genomic DNA extraction of deteriorating spore-forming bacteria from milk. Semina-ciencias Agrarias, 37(5), 3069-3078.
  19. Farhan, Z. A., & Al-Iedani, A. A. (2019). Molecular detection of Shiga toxin (stx1 and stx2) and intimin (eae A) genes in Escherichia coli isolated from fecal samples of cattle, sheep, and human in Basrah governorate. Basrah J Vet Res, 18(2), 288-305.
  20. Farhan, Z. A., & Al-iedani, A. A. (2021). The phylogenetic groupings of Escherichia coli isolated from human and farm animal feces in Basrah district, Iraq. Nveo-Natural Volatiles & Essential Oils Journal; 8982-8990.
  21. Gharieb, N. M., Twad, A. E., Ashraf, A., & El Oksh, A. S. (2023). Prevalence of multidrug resistant Shiga toxin-producing Escherichia coli in broiler. Benha Veterinary Medical Journal, 44(2), 64-69.
  22. Yang, X., Bai, X., Zhang, J., Sun, H., Fu, S., Fan, R., He, X., Scheutz, F., Matussek, A., & Xiong, Y. (2020). Escherichia coli strains producing a novel Shiga toxin 2 subtype circulate in China. International Journal of Medical Microbiology, 310(1), 151377.
  23. Nataro, J. P., & Kaper, J. B. (1998). Diarrheagenic Escherichia coli. Clinical Microbiology Reviews, 11(1), 142-201.
  24. Wani, S. A., Bhat, M. A., Samanta, I., Nishikawa, Y., & Buchh, A. S. (2003). Isolation and characterization of Shiga toxin‐producing Escherichia coli (STEC) and enteropathogenic Escherichia coli (EPEC) from calves and lambs with diarrhoea in India. Letters in Applied Microbiology, 37(2), 121-126.
  25. Adzitey, F., Assoah-Peprah, P., Teye, G. A., Somboro, A. M., Kumalo, H. M., & Amoako, D. G. (2020). Prevalence and antimicrobial resistance of Escherichia coli isolated from various meat types in the Tamale Metropolis of Ghana. International journal of food science, 2020(1), 8877196.
  26. Wani, S. A., Samanta, I., Bhat, M. A., & Nishikawa, Y. (2004). Investigation of Shiga toxin‐producing Escherichia coli in avian species in India. Letters in applied microbiology, 39(5), 389-394.
  27. Kobayashi, H., Pohjanvirta, T., & Pelkonen, S. (2002). Prevalence and characteristics of intimin-and Shiga toxin-producing Escherichia coli from gulls, pigeons and broilers in Finland. Journal of Veterinary Medical Science, 64(11), 1071-1073.
  28. Momtaz, H., & Jamshidi, A. (2013). Shiga toxin-producing Escherichia coli isolated from chicken meat in Iran: Serogroups, virulence factors, and antimicrobial resistance properties. Poultry science, 92(5), 1305-1313.
  29. Mamun, M. M., Parvej, M. S., Ahamed, S., Hassan, J., Nazir, K. H. M. N. H., Nishikawa, Y. and Rahman, M. T. (2016). Prevalence and characterization of shigatoxigenic Escherichia coli in Broiler birds in mymensingh. Bangl. J. Vet. Med.; 14 (1): 5-8.
السنة 23، العدد 4
الخريف 2024
الصفحة 1-9

  • تاريخ الاستلام 27 تموز / يوليو 2024
  • تاريخ القبول 14 أيلول / سبتمبر 2024
  • تاريخ النشر 30 كانون الأوّل / ديسمبر 2024