(ctfA),(Nuc) و (spa A) التحدید الجزیئی للجینات المشفرة فی العنقودیة الذھبیة المقاومة للمیثاسلین العزولة من التھاب الضرع فی الابقار

نوع المقالة : بحث

المؤلف

فرع الاحیاء المجھریة، کلیة الطب البیطری ، جامعة واسط ،واسط ،العراق

10.23975/bjvetr.2016.172796
الملخص
تعتبر المکورات العنقودیة الذھبیة المسؤولة عن الاصابة داخل الثدی فی الأبقار وھی المسبب المرضی
الرئیسی لالتھاب الضرع السریری وتحت السریریة فی قطعان الأبقار الحلوب. فی ھذه الدراسة تم الحصول على 64
عترة من المکورة العنقودیة الذھبیة من 112 عینة من ابقار مصابة بالتھاب الضرع وبنسبة ( 57.14 ٪). وقد تم
تحدید العنقودیة ظاھریا بالاضافة الى ذلک تم تشخیصھا جینیا بتفاعل سلسلة البلمریز. تضخیم الجین المشفر
تضاعف الجین المشفر لتحدید النوع انتج حزم الحمض النووی بوزن .Spa و Nuc و ctfA و Sua لتحدید النوع
فظھر التضاعف بوزن Spa . % 980 وبنسبة عزل 73.43 CtfA جزیئی 530 فی کل العتر وبوزن جزیئی تقریبا
تضاعف بوزن جزیئی 279 Nuc. % جزیئی 950 فی 43 عترة و 3 عتر تحتوی وزن جزیئی 390 وبنسبة 71.87
وبنسبة 90.62 %. بعد ذالک تم تحدید المقاومة لمیثاسلین فظھرت بنسبة 21.87 % وظھرت جمیع العتر المقومة
للمیثاسلین تحتوی على جینات الضراوة
Crossmark

Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
199
MOLECULAR DETECTION OF GENES ENCODING CLUMPING
FACTOR (CTFA), THERMONUCLEASE (NUC) AND
IMMUNOGLOBULIN G BINDING REGION OF PROTEIN A
(SPA)FROM METHICILLIN RESISTANCE STAPHYLOCOCCUS
AUREUS ISOLATED FROM BOVINE MASTITIS.
Basim Mohammed Hanon
Department of Microbiology, College of Veterinary Medicine, University of
Waste,Waste, Iraq
Keywords: Mastitis, S. aureus, PCR, MRSA.
ABSTRACT
The Staphylococcus aureus responsible for intramammary infection in bovine and
is the main etiological agent of clinical and subclinical mastitis in dairy herds. In this
study a total of 64 Staphylococcus aureus strain obtained from 112 samples from mastitis
cow (57.14%). S. aureus strain were identified phenotypically and further characterized
genotypically by polymerase chain reaction PCR. Amplification of genes encoding
specific species for S. aureus(Sau), clumping factor (ctfA), thermonuclease (Nuc) and the
gene segment encoding the immunoglobulin G binding region of protein A gene spa. The
amplification of Sau gene produce amplicon in a molecular size proximally 530bp in all
strain, the produce amplicon in a molecular size proximally size 980 bp in ctfA gene
(73.43%) andImmunoglobulin G binding region of spa gene produce amplicon in a size
proximally 950 bp was observed in 43 and 3 strain amplicon in a size proximally 390 bp
(71.87%). The thermonuclease gene the amplicon in a size proximally 279 bp with
(90.62%). After that methicillin resistance (MRSA) were detected in a percentage
(21.87%), all of these strain of MRSA contain all virulence genes.
INTRODUCTION
Mastitis is one of the major causes of economic losses in dairy industry worldwide,
microorganisms involved the major organism is S. aureus(1).S. aureusis the main
etiological agent of clinical and subclinical mastitis in dairy herds (2).
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
200
S. aureus is a ubiquitous Gram-positive microorganism commonly isolated from
raw milk of dairy cattle suffering from mastitis. So its presence in raw milk is a major
concern for the safety and the quality of traditionally dairy products (3).
Bovine mastitis, a multi-factorial disease, is characterized by physical, chemical
and microbiological changes in the milk and pathological changes in the glandular tissue
of udder (4). In the control of mastitis, the improper use of antimicrobial agents on dairy
farm animals is a major concern as it lead to the emergence of resistant zoonotic bacterial
pathogens (5). The intra mammary administration of antibiotics used on farms has
increased, as it was proved to be effective for treating subclinical mastitis in dry small
ruminants (6).
The main reservoir of S. aureus seems to be the infected quarter and transmission
between cows usually occurs during milking (7).
S. aureus causing wide spectrum of diseases in both human and animal. S. aureus
expresses many potential virulence associated factors like surface proteins that promote
colonization of host tissue surface factors that inhibit phagocytic engulfment (capsule
protein A) biochemical properties that enhance their survival in phagocyte (catalase
production) immunological disguises (protein A, clottin factor) inherent and acquired
resistance to antimicrobial agent and membrane damaging toxins like hemolysis that lyse
eukaryotic cell membranes (8). One of the major surface proteins is staphylococcoal
protein A (spa) which bacterial cell wall product that bind immunoglobulin G and impair
opsonisation by serum complement and phagocytosis by polymorphnuclear leukocytes
(9) Protein A is a surface protein of S. aureus which binds IgG molecules by their Fc
region in serum the bacteria will bind IgG molecules in the wrong orientation on their
surface which disrupts opsonization and phagocytosis (10). The decrease of protein A on
the cell on surface of S. aureus resulted in greater number of free receptor sites for
complement C3b and in increase in phagocytosis (9).
Clumping factor A (ctfA)is the surface antigen which acts as adhesions factor, and
considered to be one of the most important adhesion factors of S. aureus to host cells,
(ctfA) is known to participate in the infection process by binding via soluble or
immobilized fibrinogen (11). This factor has been shown to inhibit phagocytosis in the
absence of fibrinogen and the inhibition was enhance in the presence of fibrinogen (12).
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
201
Methicillin-resistant S. aureus (MRSA) includes S.aureus that have acquired a
gene, called mecA, giving them resistance to methicillin and essentially to all other betalactam
antibiotics. MRSA was first reported as a nosocomial pathogen in 1961, soon after
methicillin was introduced into human medicine to treat penicillin-resistant staphylococci
(13). MRSA clones have particularly been detected in animal populations (14, 15).
Although MRSA is associated with the acquiredmecA gene, the role of inappropriate
antibiotics use should also not be under estimated in formation of bacterial resistance and
multidrug resistant strains (16). MRSA infection from mastitis cases is partly related with
failure in dosage therapy and choice of antimicrobial substance (14, 17).
The aim of this study detection S. aureus strain phenotypically and genotypically
from clinical and sub clinical mastitis and study virulence profile with determination
Methicillin resistant S. aureus MRAS.
MATERIALS AND METHODS
Samples collection
One hundred twelve (112) samples were obtained from diseases pathogenic and
clinically apparent healthy non-pathogenic cases of bovine. The isolation of
staphylococcus was attempted depend on clinical sign and decrease milk production that
tested by California mastitis test (CMT) for subclinical mastitis and were graded as
negative, trace, weak, distinct, or strong positive (4). The specimens were transported to
the laboratory directly and inoculated ontoMannitol salt agar (MSA)platesHimedia -
India; and incubated at 37°C for 24 h. All colonies from primary cultures were purified
by sub culturing onto MSA medium and incubated at 37°C for 24 to 48 h (18).
Biochemical testes
Different tests were performed for identification of S. aureus. The tests were
catalase test; oxidase test; coagulase; clumping factor test; free coagulase test; Vogas-
Proskauer test; ONPG ; Latex agglutination (MASTSTAPH); heamolysin production;
DNAase production test; Urease test; O\F test; gelatin test; methyl red test and sugar
fermentation test. The tests were done using the methods of (19, 20). API Staph test was
done for the conformity of the identification of isolates. Homogenous bacterial
suspension was prepared with a turbidity equivalent to 0.5 McFarland stander (21).
DNA isolation
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
202
KAPA Express Extract KK7100 (50 rxns) Transfer DNA containing supernatant to
a fresh tube,and diluted in TE buffer for long term storage at -20 Cº(KAPA
BIOSYSTEMS USA).Genotypic characterization Kit, KAPA Taq Ready Mix,DNA
polymerase contain Taq DNA polymers (0.0 5U /1.25 U per 25 ul) Reaction buffer with
Mg +2 and o.4 mM each dNTP with or without dye. (KAPA BIOSYSTEMSUSA).A
ladder (KAPA BIOSYSTEMSUSA), size of amplicons KAPA Universal ladder contain
(100 ng/μl) 1x1 ml KAPA loading dye (60x) x1.5 ml contain eighteen DAN segment.
Sau gene to specific species S. aureus
PCR amplification was don as follow 5 μl of DNA was added to 20 μl of master
mix with 0.6 μmol each primers for Sau gene to specific species S. aureus described by
(22). The thermal cycling parameters were an initial denaturation step (94 Cº 4min) 25
cycle amplification including denaturation (94 Cº 30 s) annealing (54 Cº, 30 s) DNA
chain extension at 72 Cº for 7 min were done in thermal cycler 10 μl volumes of PCR
products were electrophoreses in 1.5% (w/v) agarose gel 1h ethidium bromide (0.5 μg/ml
TAE) stained DNA amplicons were visualized in UV transilluminator.
Clumping factor (ctfA) gene
This genesencoding clumping factor (ctfA) initial denaturation at 94 Cº for 4 min,
followed by 38 cycle of denaturation, annealing and extension (94 Cº for 60s, 58 Cº for
60s 72Cº for 60s) and final extension at 72 C for 5 min (22).
IgG binding –region of protein A (spa) gene
The PCR amplification was don under Initial denaturation at 94 Cº for 2 min ,
followed by 30 cycle of denaturation ,annealing and extension ( 94 Cº for 3 min 58 Cº for
30s ,72 Cº for 45s) and final extension at 72 Cº for 10 min ,The sequences of the
oligonucleotide primers summarized in Table 1 .
Thermonuclease (nuc)gene
Reaction mixtures (25 μl) included 2 μl template DNA, 20μl of master max, 10
pmol of each of the 2 primers 279 bp. Amplification and primer described by (22) A total
of 37 PCR cycles were run under the following conditions: denaturation at 94°C for 1
min, annealing at 55°C for 0.5 min, and extension at 72°C for 1.5 min. After the final
cycle, the reaction was terminated final extension keeping it at 72°C for 3.5 min.
Amplified products were separated by agarose gel electrophoresis (1.7% agarose) at 5
V/cm for 3 h and photographed under UV illumination.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
203
Table 1 primers for amplification of S. aureus gene (sequence (5-3) size of amplified bp.
Gene Sequence Size
bp
Reference
Sau F:ATAAGAGATGGCGGTACTAAA
R:TAAGGCGGATTACACGTTACT
530 (Ruzickova et al.,
2005)
CtfA F:GGCTTCAGTGCTTGTAGG
R:TTTTCAGGGTCAATATAAGC
980 (Stepan et al., 2001)
Nuc F:CGATTGATGGTGATACGGTT
R:ACGCAAGCCTTGACGAACTAAAGC
279 (Stepan et al., 2001)
Spa F:CACCTGCTGCAAATGCTGCG
R:GGCTTGTTGTTGTCTTCCTC
950 (Stepan et al., 2001)
mec F:5' AAA ATC GAT GGT AAA GGT TGG C 3'
R: 5' AGT TCT GCA GTA CCG GAT TTG C 3'
533 (Murakami et al.,
1991)
Cefoxitin sensitivity testing
This test was done according to method of Kirby and Bauer(23) disc-diffusion
method, S. aureus isolates were tested for their sensitivity to cefoxitin (cx 30 mg). A zone
of inhibition with a diameter of ≤ 21 mm was considered as an indication for resistance to
methicillin.
Genotypic screening (PCR amplification for detection of mecA gene)
All S. aureus isolates were screened for mecA gene by PCR assy. The mecA gene
was described by (24). Reaction mixtures include 20μl of master max, 20 pmol
concentrations of forward and reverse primers and 5 μl of DNA template. The cycling
parameters were as follows: an initial denaturation at 94°C for 5 min; followed by 40
cycles of 94°C for 30 s, 55°C for 30 s, and 70°C for 1min; the final extension was at
72°C for 5 min . PCR products were visualized on 2% agarose gel with ethidium bromide
under UV transilluminator. Amplicons of 533 bp were consistent with mecA gene
amplification.
Statistical methods:
The significance of differences in proportions was analyzed by the chi-square test.
Fisher’s exact test was used when there was a cell with a number less than 5. Data were
performed with SPSS version 15 and P values equal or less than 0.05 were considered
statistically significant.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
204
RESULTS
Out of 112 milk samples which collected from dairy cows S. aureus isolates were
64 (57.14%) samples were found positive depend on biochemical test that used. S. aureus
isolates were similar in some biochemical tests like catalase, oxidase, coagulase, O/F,
ONPG, MR, sugar fermentation, gelatin liquefaction, latex agglutination and API Staph.
All tests were positive at 100%. The different percentage in biochemical test, hemolysis
on blood agar (90.62%) VP test (93.75%) urease test (92.18%), DNase 96.87%, S. aureus
isolates of bovine origin produced beta- haemolysis.
Table 2:- Number and percentage of sample test with biochemical test detection S aureus.
Sample Growth on
MSA
Coagulase
tube
Coagulase
slide
Oxidase
negative
Suspected
S aureus
112 64 100% 64 100% 47 73% 112 100% 64 57.14%
X2 =42.749 P= 0.0004
Suspected
S aureus
Heamolysis Urease VP test DNase API staph
64 58 90.62% 59 92.18% 60 93.75% 62 96.87% 64 100%
X2 =0.479 P= 0.976
However, all the isolates were subjected to PCR assay used test with sua gene to
diagnostic specific species of S. aureus amplification yielded of 530 bp in all isolates this
gene not product polymorphism (Fig.1).
Amplification of the clumping factor (ctfA) gene has yeild amplicon with a size of
approximately 985 bp 47 strain from 64 S. aureus isolates were positive to (ctfA) gene
(Fig. 2).
Out of 64, 43 produce single band a proximally of 950 bp was developed with PCR
amplification of the gene segment encoding IgG binding region of protein ASpa (Fig. 3)
and 3 isolated in 390 bp (Fig. 4), while the amplification of extracellular thermonuclease
Nuc gene produced an amplicon of proximally279 bp in 58 out of 64 isolates (fig.5).All
the gene with number of positive showing in (Table 2). While the mec A was appeared in
533 bp (Fig.6) the percentage of isolated of MRAS was appeared in (21.87%), all of these
strain of MRSA contain all virulence genes.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
205
Table 2:- Number and percentage of genes detection in the S aureus.
No. Sau gene ctfA gene spa gene Nuc gene Mec A
Strains 530 bp 985 bp 950 bp 390 bp 278 bp 533bp
64 64/ 64 47 / 64 43 / 64 3/ 64 58/ 64 14/64
Percentage 100% 73.43% 67.18% 4.68% 90.62% 21.87%
X2 = 93.783 P= 0.0002
Fig.2 Gel electrophoresis (1% agarose, 7 v/cm2, 1.
hrs) of PCR positive products for (ctfA) gene was
appeared in 985 bp, L1:- 100bp DNA ladder.
Fig.4 Gel electrophoresis (1% agarose, 7 v/cm2, 1.
hrs) of PCR positive products for Spa gene was
appeared in950 bp, L1:- 100bp DNA ladder.
Fig.3 Gel electrophoresis (1% agarose, 7
v/cm2, 1. hrs) of PCR positive products
forSpagenewas appeared in360 bp, L1:- 100bp
DNA ladder.
Fig.2. Gel electrophoresis (1% agarose, 7 v/cm2,
1. hrs) of PCR positive products for (sua) gene
was appeared in 530 bp, L1:- 100bp DNA
ladder.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
206
Fig.6 Gel electrophoresis (1% agarose, 7 v/cm2, 1.
hrs) of PCR positive products for Nucgene was
appeared in 279bp, L1:- 100bp DNA ladder.
DISCUSSION
In the present study S. aureus strains isolated from subclinical bovine mastitis cases
were identified (phenotypically) by biochemical test and characterized by PCR
amplification of several virulence genes encodingSaufor species of S aureus clumping
factor ctfA, Spa gene segment encoding the immunoglobulin G-binding region and Nuc
gene encoded stable of thermonuclease activity and mec A gene encoded for MRSA.
In this study combined with other study in Iraq Al –Kafaje (2008) (25) found that
percentage of isolation (46.24%) in clinical and sub clinical mastitis. (26) Al – Marsomy
(2008) recorded that the percentage (43.5%) while the study (27) Mustsafa (2007)found
the percentage of isolation from clinical and subclinical mastitis (46.24%).
The isolation rates of S. aureus observed in the present study are consistent with
findings in other studies(28) identified a total of 245 strains of S. aureus, among which
(61.2%) were derived from milk. In another study (29) observed S. aureus in 67% of
isolates from raw milk. Worldwide, several studies suggest that S. aureus isolation rates
in milk can vary from (13.5%) to (64.7%) (30, 31).
The Sua gene product 533bp control amplicon derived from species-species
genomic sequence was present in all S. aureusinvestigated in this study, this result
combined with the study of (32) that used similar primer to code to specific S. aureus.
The spa gene 69 samples encoded to IgG binding region gene but in this study
appear 43 strain product molecular weight 390 bp these genes are the most frequent inS.
aureus. The PCR amplification of the gene encoding the IgG binding region of protein A
spa revealed a size of 950 bp for most of the isolates investigated (9)
Fig.5. Gel electrophoresis (1% agarose, 7 v/cm2, 1.
hrs) of PCR positive products for mecAgene was
appeared in533 bp, L3:- 100bp DNA ladder
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
207
Spa gene produced different products ranging in size from 190bp to 320bp (33).
PCR revealed that from all the coagulase positive S. aureus isolates (98.5%) had spa
(spa-X) gene(34), while another study determine the spa. gene in(46.8%) (35).
The amplification of the clumping factor (ctfA) gene resulted in a single amplicon
with a size of approximately 1,000 bp and eight isolated contain 950 bp (22), but in this
study indicating no size polymorphism of this gene in all isolated had a size of 985 bp.
Polymorphism with on information is available about the sequence variation of these
strains. However (36, 37) reported amplicons at 900-950 bp in molecular weight in fewer
isolated as well as amplicons at 985 bp in most of the isolated they examined even though
sequence variances were reported in previous studies there is still insufficient knowledge
related to the polymorphism in this gene.
Presence of the clfA gene and the gene encoding the X-region of the protein A are
considered as the Staphylococcus spp. virulence genes in development and severity of
mastitis (36, 38).
PCR amplification of the gene encoding the IgG binding region of protein A
revealed 3 strain contain 390 bp amplicon this result combined with other study of
Akineden(36). These three strains the PCR products were 390 bp smaller because the
fragment size that is required to encode one IgG binding domain a alack of two domains
is assumed for these strains Comparable spa gene polymorphisms were observed by (22,
39).
PCR analysis of Nucand ctfA genes in the investigated strains suggested an
important role of these elements in the pathogenicity of bovine mastitis. (9)
The Nuc gene PCR analysis of the other virulence genes revealed investigated
important role of these elements in the pathogenicity role of mastitis (8)
Some studiesisolated S aureusin 69of 360 (19.16%) milk samples,63(91.30%)
specimens contained the clfA gene, 69 specimens contained the spa gene 22(31.88%)
specimens contained spa gene (IgG Binding region) (40).
The prevalence of S. aureus has been reported to vary with the size and geographic
region in the world. The improper hygiene and poor management practices contributed to
the presence of S. aureus in the milk (41, 42).
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
208
Molecular detection of methicillin resistance in Staphylococci from cases of bovine
mastitis and persons handling the infected cattle the role of animals as reservoir for
MRSA infection to humans (43).
A total of 151(31.45%) S.aureus isolates were identified by API-Staph® detection,
(41.05%) isolates were determined as resistant to cephoxitin (30 ìg) demonstrates the
distribution of mecA carrying S. aureus isolates and their locations in Turkey (44).
A total of 235 clinical mastitis milk samples from dairy cows were cultured for
incidence of S. aureus. Methicillin resistant S. aureus was isolated from a total of 12
(44.25%) of the 116 S. aureus samples. Basedon the antimicrobial sensitivity and MIC
results (45).
It has now become an increasingly urgent problem in veterinary medicine with MRSA
infections reported in small animals and cattle (46).
The detection of mecA gene by PCR is accepted as “gold standard”. Detection of
methicillin resistance is influenced by several factors as mec regulatory genes, β-
lactamase regulatory genes (18, 47).
(ctfA),(Nuc) و (spa A) التحدید الجزیئی للجینات المشفرة
فی العنقودیة الذھبیة المقاومة للمیثاسلین العزولة من التھاب الضرع
فی الابقار
باسم محمد حنون
فرع الاحیاء المجھریة، کلیة الطب البیطری ، جامعة واسط ،واسط ،العراق
الخلاصة
تعتبر المکورات العنقودیة الذھبیة المسؤولة عن الاصابة داخل الثدی فی الأبقار وھی المسبب المرضی
الرئیسی لالتھاب الضرع السریری وتحت السریریة فی قطعان الأبقار الحلوب. فی ھذه الدراسة تم الحصول على 64
عترة من المکورة العنقودیة الذھبیة من 112 عینة من ابقار مصابة بالتھاب الضرع وبنسبة ( 57.14 ٪). وقد تم
تحدید العنقودیة ظاھریا بالاضافة الى ذلک تم تشخیصھا جینیا بتفاعل سلسلة البلمریز. تضخیم الجین المشفر
تضاعف الجین المشفر لتحدید النوع انتج حزم الحمض النووی بوزن .Spa و Nuc و ctfA و Sua لتحدید النوع
فظھر التضاعف بوزن Spa . % 980 وبنسبة عزل 73.43 CtfA جزیئی 530 فی کل العتر وبوزن جزیئی تقریبا
تضاعف بوزن جزیئی 279 Nuc. % جزیئی 950 فی 43 عترة و 3 عتر تحتوی وزن جزیئی 390 وبنسبة 71.87
وبنسبة 90.62 %. بعد ذالک تم تحدید المقاومة لمیثاسلین فظھرت بنسبة 21.87 % وظھرت جمیع العتر المقومة
للمیثاسلین تحتوی على جینات الضراوة.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
209
REFERENCES
1. Gentilini, E.; Denamiel, G. and Betancor, A. (2002). Antimicrobial susceptibility
of COAGULASE NEGATIVE StaphylococcI isolated from bovine mastitis in
Argentina. J. Dairy Sci., 85: 1913-1917.
2. Gilbert, F. B.;Fromageau, A.;Gelineau,andPoutrel, M. (2006). Differentiation of
bovine staohyloccus aureus isolates by use of poylmorphic tandem repeat typing.
Vet. Microbiol., 117:297-303
3. D
elbes, C.; Alomar, J.; Chougui, N.; Martin, J. F. and Montei, M. C.
(2006).Staphylococcus aureus growth and entertoxin production during the
manufacture of uncooked,semi hard cheese from cow's raw milk. j. Food Prot., 69:
2161- 2167.
4. Radostits, O. M., Blood, D. C. and Gay, G. C. (2008). Veterinary Medicine. A
Textbook of the Diseases of cattle, sheep, pigs, goats and horses. 10th Ed., Bailliare
Tindall, London.
5. Piddock, L. J. V. (1996). Does the use of antimicrobial agents in veterinary
medicine and animal husbandry select antibiotic resistant bacteria that infect man and
compromise antimicrobial chemotherapy? J. Antim.Chemo. 38: 1-3.
6. Olechnowicz, J. and Jaskowski,J.M. (2014). Mastitis in small ruminants. Med.
Weter, 70: 67-72
7. Marrack, P. and Kappler, R. (1990). The staphylococcus enterotoxins and their
relatives. science, 248:705-711
8. Todar, K. (2008).Staphylococcus aureus text book of bacteriology. University of
wisconsin- medison. Department of bacteriology.
9. Gao, J. and Stewart, G.C. (2004). Regulatory elements of the Staphylococcus
aureus protein A (Spa) promoter. J. Bacteriol. 186:3738-3748
10. Harraghy, N. ; Hussain, M. ; Haggar, A. ; Chavakis, T. ; Sinha, B. ; Herrmann,
M. and Flock, J. (2003). The adhesive and immunomodulating properties of the
multifunctional staphylococcus aureus protein. Eap. Microbioloy. 149: 2701-2707.
11. McDevitt, D.; Francois, P.; Vaudaux, P. and Foster, T. J. (1994). Molecular
characterization of the clumping factor (fibrinogen receptor) of Staphylococcus
aureus. Mol Microbiol 11, 237–248
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
210
12. Higgins, J; Loughman, A. and Van foster, T. J. (2006). Clumping factor of
staphylococcus aureus inhibits phagocytosis by human polymophnuclear leucocyte.
Fems Microbiol Lett, 258:290-296.
13. OIE & Iowa State University. The Center for Food Security and Public Health &
Institute for International Coorperation in Animal Biologics. Methicillin Resistant
Staphylococcus aureus (MRSA)Last Updated: 2016, www.cfsph.iastate.edu
14. Feâler, A. ; Scott, C.; Kadlec, K.; Ehricht. R. ; Monecke, S. and Schwarz,
S.(2010): Characterization of methicillin-resistant Staphylococcus aureus ST398
from cases of bovine mastitis. J Antimicrobial. Chemotherapy,65, 619–625.
15. Lee, JH. (2003). Methicillin (Oxacillin)-resistant Staphylococcus aureus strains
isolated from major food animals and their potential transmission to humans. Appl
Environ Microbiol, 69, 6489-6494.
16. Chambers, HF. (1997). Methicillin resistance in staphylococci: molecular and
biochemical basis and clinical implications.Clin. Microbiol. Rev, 10, 781-791.
17. Juhasz-Kaszanyitzky, E, ; Janosi S, ; Somogyi, P, ; Adam, D, ; Linda VD, ;
Graaf-Van B, ; Engeline VD, ; Jaap AW (2007). MRSA Transmission between
Cows and Humans, Emerg Inf Dis, 13, 630-632.
18. Talan, DA. ; Staatz, D.; Staatz, A.; Goldstein, E. JC. ; Singer, K. and Ocrturf,
GD. (1989).Staphylococcus intermedius in canine gingiva and canine-inflicted
human wound infections: Laboratory characterization of a newly recognized
zoonotic pathogen. J Cli Microb 27(1):78-81
19. Finegold, SM. and Baron, EJ. (1986). Methods for testing antimicrobial
effectiveness in Baily and Scott's diagnostic microbiology. 7th Ed. The C. V. Mos.
By Co. West line. Industrial Drive, St., Louis, Missuri, USA.
20. Baron, EJ. ; Peterson, LR. and Finegold, SM. (1994). Bailey and Scott's
Diagnostic Microbiology 9th Ed. Mosby St. Louis.
21. Macfaddin, JF. (2000). Biochemical tests for identification of medical bacteria. 3rd
Ed. Lippincott Williams and Wilkins USA.
22. Stephan, R.; Annemuller, C.; Hassan, A. A. and Lammler, C. (2001).
charaterization of enterotoxigenic taphylococcus aureus strains isolated from bovine
mastitis in north- east switzerland. Vet Microbiol, 78: 373-382.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
211
23. K
irby, W. M. and Bauer, A. W. (1966). Antibiotic susceptibility testing by a
standardized single disc method .The American. J. Clin. Path. 45 (4): 493-496.
24. M
urakami, K. ; Minamide, W. ; Wada, K. ; Nakamura, E. ; Teraoka, H.
and Watanabe, S.(1991). Identification of methicillin-resistant strains of
staphylococci by polymerase chain reaction. J Clin Microbiol 29: 2240-2244.
25. A
l- Kafaji, N. A.(2008).Expermintal study for the effect of plantago lanceolata and
eugenia caryophyllus extract in the growth and pathogenesis of staphylococcus
aureus in laboratory animala. MSc. Thesis, Collage of Veterinary Medicine,
university of Baghadad.
26. A
L - Marsomy, H. M. (2008). Isolation and diagnostic some causative bacterial,
causes mastitis in cows and role lactobacillus secretion at inhibition growth of
Staphylococcus aureus. M.Sc., Thesis, College of Veterinary Medicine, University of
Baghdad.
27. M
ustafa, J. Y. (2007). Isolation of some bacterial causative agent of bovine mastitis,
with extraction and purification of Staphylococcus aureus B-lactamase. M Sc.
Thesis, College of Veterinary Medicine, University of Basrah.
28. Z
afalon, L.F. ; Arcaro, J.R.P. ; Filho, A.N. ; Ferreira, L.M. and Veschi, J.L.A.
(2009). Toxin gene-carrier Staphylococcus aureus isolated from diverse transmission
sources during the milking. Rev Inst Adolfo Lutz, 68(2):269-77,
29. B
orges, M.F. ; Nassu, R.T. ; Pereira, J.L. ; de Andrade, A.P.C. and Kuaye, A.Y.
(2008). Contamination profile for staphylococci and its enterotoxins and
monitorization of the conditions of hygiene in a ‘coalho’ cheese production line.
Recebido para publicação 23.05.07
30. S
umathi, B.R. ; Veeregowda, B.M. and Amitha, R.G. (2008). Prevalence and
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
212
Antibiogram Profile of Bacterial Isolates from Clinical Bovine Mastitis. Vet World,
8, 237-238.
31. U
nakal, C.G. and Kaliwal, B.B. (2010). Prevalence and Antibiotic Susceptibility of
Staphylococcus aureus from Bovine Mastitis. Vet World, 3, 65-67.
32.
Ruzickova, V.; Voller, J.; Pantucek,R.; petras, p. and doskarot, j.
(2005).Multiplex PCR for detection of tree exooliaive toxin serotype genes in
staphylococcusaureus.Folia Microbiol.50 (60), 499-502.
33. Karahan, M.; Acik, M.N. and Cetinkaya, B. (2011). Investigation of virulence
genes by PCR in Staphylococcus aureus isolates originated from subclinical bovine
mastitis in Turkey. Pak. Vet. J. 31:249-253.
34. Ahrar, K., A. ; Hussain, R., Javed, M. and Mahmood, F. (2013). Molecular
analysis of virulent genes (COA AND SPA) OF Staphylococcus aureus involved2 in
natural cases of bovine mastitis. Pak. J. Agri. Sci., Vol. 50(4), 739-743.
35. Santos, M.; Martins B., and Rezende S. (2014).Virulence Factor Profile of
Staphylococcus aureus isolated from Bovine Milk from Brazil.Food and Nutrition
Sciences. 5, 1496-1505.
36. Akineden, O. C.; Annemuller, A. A. ; Hassan, C. ;Lammler, W. ; Wolter and
Zschock, Y. (2001).Toxin genes and other characteristics of Staphylococcus aureus
isolates from milk of cow with mastitis. Clin Diagn Lab Immunol, 8:959-964.
37. Reinoso, E. B.; El- Sayed, A.; Lammder, C.; Bogni,C. and Zschock, M. (2008).
Genotyping of stapylococuus aureus isolated from humans, bovins subclinical
mastitis and food samples in Argentina. Microbiol Res, 163" 314-322.
38. Sharma, NK. ; Rees, CE. and Dodd, CE. (2000). Development of a singlereaction
multiplex PCR toxin typing assay for Staphylococcus aureus strains. Appl. Environ.
Microbiol. 66: 1347-1353.
39. Schwarzkopf, A.; Karch, H.; Schmidt, H.;Lenz, W. and Heesemann, J. (1993).
Phnotypical and genotypical charcterization of epidemic clumping factor negative,
oxacillin- resistant staphylococcus aureus. JClin Microiol.; 31: 2281-2285.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
213
40. Momtaz, H. ; Rahimi E. and Tajbakhsh,(2010). Detection of some virulence
factors in Staphylococcus aureus isolated from clinical and subclinical bovine
mastitis in Iran.African Journal of Biotechnology Vol. 9(25), pp. 3753-3758
41. Abo-Shama, U.H.(2014). Prevalence and antimicrobial susceptibility
of Staphylococcusaureus isolated from cattle, buffalo, sheep and goats raws milk in
Sohag Governorate, Egypt. Assiut. Vet. Med. J., 60: 63-72
42. Lee, YJ. ; Chen, JZ. ; Lin HC. ; Liu HY. ; Lin, SY. ;Lin HH. ; Fang CT. and Hsueh,
PR. (2015). Impact of active screening for Methicillin-Resistant Staphylococcus
aureus (MRSA) and decolonization on MRSA infections, mortality and medical cost:
A quasi-experimental study in surgical intensive care unit. Crit. Care, Vol. 19.
43. Vishnupriya, S. ; Antony, P. X. ; Mukhopadhyay, H. K. ; Pillai, R. M. ;
Thanislass, J. ; Vivek Srinivas, V. M. and Sumanth Kumar R (2014). Methicillin
resistant staphylococci associated with bovine mastitis and their zoonotic
importance. Veterinary World, 2231-0916. P422-427.
44. Buyukcangaz, E. ; Kahya, S. ; Sen, A. ; Seyrek, K. ; Eyigor, A. ; Temelli, S. and
Tayfun K. (2013).MecA Gene Prevalence in Staphylococcus aureus Isolates from
Dairy Cows in Turkey.J. Biol. Environ. Sci., 7(21), 183-190
45. Chandrasekaran, D. ; Venkatesan, P. ; Tirumurugaan, K. G. ; Nambi, A. P.;
Thirunavukkarasu, P. S. ; Kumanan, K. and Vairamuthu, S. (2014). A study on
Methicillin resistant Staphylococcus aureus mastitis in dairy cows. Journal of
Applied and Natural Science 6 (2): 356-361.
46. Rahimi, H. ; Saei,H.D. and Ahmadi,M. (2015). Nasal carriage of Staphylococcus
aureus: Frequency and antibiotic resistance in healthy ruminants. Jundishapur J.
Microbiol., Vol. 8, No. 10. 10.5812.
47. Sancak, B. (2000).Staphylococcus aureus methicillin resistance mechanisms.
Microbiol Bulletin. 34: 381-389.

1. Gentilini, E.; Denamiel, G. and Betancor, A. (2002). Antimicrobial susceptibility
of COAGULASE NEGATIVE StaphylococcI isolated from bovine mastitis in
Argentina. J. Dairy Sci., 85: 1913-1917.
2. Gilbert, F. B.;Fromageau, A.;Gelineau,andPoutrel, M. (2006). Differentiation of
bovine staohyloccus aureus isolates by use of poylmorphic tandem repeat typing.
Vet. Microbiol., 117:297-303
3. D
elbes, C.; Alomar, J.; Chougui, N.; Martin, J. F. and Montei, M. C.
(2006).Staphylococcus aureus growth and entertoxin production during the
manufacture of uncooked,semi hard cheese from cow's raw milk. j. Food Prot., 69:
2161- 2167.
4. Radostits, O. M., Blood, D. C. and Gay, G. C. (2008). Veterinary Medicine. A
Textbook of the Diseases of cattle, sheep, pigs, goats and horses. 10th Ed., Bailliare
Tindall, London.
5. Piddock, L. J. V. (1996). Does the use of antimicrobial agents in veterinary
medicine and animal husbandry select antibiotic resistant bacteria that infect man and
compromise antimicrobial chemotherapy? J. Antim.Chemo. 38: 1-3.
6. Olechnowicz, J. and Jaskowski,J.M. (2014). Mastitis in small ruminants. Med.
Weter, 70: 67-72
7. Marrack, P. and Kappler, R. (1990). The staphylococcus enterotoxins and their
relatives. science, 248:705-711
8. Todar, K. (2008).Staphylococcus aureus text book of bacteriology. University of
wisconsin- medison. Department of bacteriology.
9. Gao, J. and Stewart, G.C. (2004). Regulatory elements of the Staphylococcus
aureus protein A (Spa) promoter. J. Bacteriol. 186:3738-3748
10. Harraghy, N. ; Hussain, M. ; Haggar, A. ; Chavakis, T. ; Sinha, B. ; Herrmann,
M. and Flock, J. (2003). The adhesive and immunomodulating properties of the
multifunctional staphylococcus aureus protein. Eap. Microbioloy. 149: 2701-2707.
11. McDevitt, D.; Francois, P.; Vaudaux, P. and Foster, T. J. (1994). Molecular
characterization of the clumping factor (fibrinogen receptor) of Staphylococcus
aureus. Mol Microbiol 11, 237–248
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
210
12. Higgins, J; Loughman, A. and Van foster, T. J. (2006). Clumping factor of
staphylococcus aureus inhibits phagocytosis by human polymophnuclear leucocyte.
Fems Microbiol Lett, 258:290-296.
13. OIE & Iowa State University. The Center for Food Security and Public Health &
Institute for International Coorperation in Animal Biologics. Methicillin Resistant
Staphylococcus aureus (MRSA)Last Updated: 2016, www.cfsph.iastate.edu
14. Feâler, A. ; Scott, C.; Kadlec, K.; Ehricht. R. ; Monecke, S. and Schwarz,
S.(2010): Characterization of methicillin-resistant Staphylococcus aureus ST398
from cases of bovine mastitis. J Antimicrobial. Chemotherapy,65, 619–625.
15. Lee, JH. (2003). Methicillin (Oxacillin)-resistant Staphylococcus aureus strains
isolated from major food animals and their potential transmission to humans. Appl
Environ Microbiol, 69, 6489-6494.
16. Chambers, HF. (1997). Methicillin resistance in staphylococci: molecular and
biochemical basis and clinical implications.Clin. Microbiol. Rev, 10, 781-791.
17. Juhasz-Kaszanyitzky, E, ; Janosi S, ; Somogyi, P, ; Adam, D, ; Linda VD, ;
Graaf-Van B, ; Engeline VD, ; Jaap AW (2007). MRSA Transmission between
Cows and Humans, Emerg Inf Dis, 13, 630-632.
18. Talan, DA. ; Staatz, D.; Staatz, A.; Goldstein, E. JC. ; Singer, K. and Ocrturf,
GD. (1989).Staphylococcus intermedius in canine gingiva and canine-inflicted
human wound infections: Laboratory characterization of a newly recognized
zoonotic pathogen. J Cli Microb 27(1):78-81
19. Finegold, SM. and Baron, EJ. (1986). Methods for testing antimicrobial
effectiveness in Baily and Scott's diagnostic microbiology. 7th Ed. The C. V. Mos.
By Co. West line. Industrial Drive, St., Louis, Missuri, USA.
20. Baron, EJ. ; Peterson, LR. and Finegold, SM. (1994). Bailey and Scott's
Diagnostic Microbiology 9th Ed. Mosby St. Louis.
21. Macfaddin, JF. (2000). Biochemical tests for identification of medical bacteria. 3rd
Ed. Lippincott Williams and Wilkins USA.
22. Stephan, R.; Annemuller, C.; Hassan, A. A. and Lammler, C. (2001).
charaterization of enterotoxigenic taphylococcus aureus strains isolated from bovine
mastitis in north- east switzerland. Vet Microbiol, 78: 373-382.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
211
23. K
irby, W. M. and Bauer, A. W. (1966). Antibiotic susceptibility testing by a
standardized single disc method .The American. J. Clin. Path. 45 (4): 493-496.
24. M
urakami, K. ; Minamide, W. ; Wada, K. ; Nakamura, E. ; Teraoka, H.
and Watanabe, S.(1991). Identification of methicillin-resistant strains of
staphylococci by polymerase chain reaction. J Clin Microbiol 29: 2240-2244.
25. A
l- Kafaji, N. A.(2008).Expermintal study for the effect of plantago lanceolata and
eugenia caryophyllus extract in the growth and pathogenesis of staphylococcus
aureus in laboratory animala. MSc. Thesis, Collage of Veterinary Medicine,
university of Baghadad.
26. A
L - Marsomy, H. M. (2008). Isolation and diagnostic some causative bacterial,
causes mastitis in cows and role lactobacillus secretion at inhibition growth of
Staphylococcus aureus. M.Sc., Thesis, College of Veterinary Medicine, University of
Baghdad.
27. M
ustafa, J. Y. (2007). Isolation of some bacterial causative agent of bovine mastitis,
with extraction and purification of Staphylococcus aureus B-lactamase. M Sc.
Thesis, College of Veterinary Medicine, University of Basrah.
28. Z
afalon, L.F. ; Arcaro, J.R.P. ; Filho, A.N. ; Ferreira, L.M. and Veschi, J.L.A.
(2009). Toxin gene-carrier Staphylococcus aureus isolated from diverse transmission
sources during the milking. Rev Inst Adolfo Lutz, 68(2):269-77,
29. B
orges, M.F. ; Nassu, R.T. ; Pereira, J.L. ; de Andrade, A.P.C. and Kuaye, A.Y.
(2008). Contamination profile for staphylococci and its enterotoxins and
monitorization of the conditions of hygiene in a ‘coalho’ cheese production line.
Recebido para publicação 23.05.07
30. S
umathi, B.R. ; Veeregowda, B.M. and Amitha, R.G. (2008). Prevalence and
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
212
Antibiogram Profile of Bacterial Isolates from Clinical Bovine Mastitis. Vet World,
8, 237-238.
31. U
nakal, C.G. and Kaliwal, B.B. (2010). Prevalence and Antibiotic Susceptibility of
Staphylococcus aureus from Bovine Mastitis. Vet World, 3, 65-67.
32.
Ruzickova, V.; Voller, J.; Pantucek,R.; petras, p. and doskarot, j.
(2005).Multiplex PCR for detection of tree exooliaive toxin serotype genes in
staphylococcusaureus.Folia Microbiol.50 (60), 499-502.
33. Karahan, M.; Acik, M.N. and Cetinkaya, B. (2011). Investigation of virulence
genes by PCR in Staphylococcus aureus isolates originated from subclinical bovine
mastitis in Turkey. Pak. Vet. J. 31:249-253.
34. Ahrar, K., A. ; Hussain, R., Javed, M. and Mahmood, F. (2013). Molecular
analysis of virulent genes (COA AND SPA) OF Staphylococcus aureus involved2 in
natural cases of bovine mastitis. Pak. J. Agri. Sci., Vol. 50(4), 739-743.
35. Santos, M.; Martins B., and Rezende S. (2014).Virulence Factor Profile of
Staphylococcus aureus isolated from Bovine Milk from Brazil.Food and Nutrition
Sciences. 5, 1496-1505.
36. Akineden, O. C.; Annemuller, A. A. ; Hassan, C. ;Lammler, W. ; Wolter and
Zschock, Y. (2001).Toxin genes and other characteristics of Staphylococcus aureus
isolates from milk of cow with mastitis. Clin Diagn Lab Immunol, 8:959-964.
37. Reinoso, E. B.; El- Sayed, A.; Lammder, C.; Bogni,C. and Zschock, M. (2008).
Genotyping of stapylococuus aureus isolated from humans, bovins subclinical
mastitis and food samples in Argentina. Microbiol Res, 163" 314-322.
38. Sharma, NK. ; Rees, CE. and Dodd, CE. (2000). Development of a singlereaction
multiplex PCR toxin typing assay for Staphylococcus aureus strains. Appl. Environ.
Microbiol. 66: 1347-1353.
39. Schwarzkopf, A.; Karch, H.; Schmidt, H.;Lenz, W. and Heesemann, J. (1993).
Phnotypical and genotypical charcterization of epidemic clumping factor negative,
oxacillin- resistant staphylococcus aureus. JClin Microiol.; 31: 2281-2285.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
213
40. Momtaz, H. ; Rahimi E. and Tajbakhsh,(2010). Detection of some virulence
factors in Staphylococcus aureus isolated from clinical and subclinical bovine
mastitis in Iran.African Journal of Biotechnology Vol. 9(25), pp. 3753-3758
41. Abo-Shama, U.H.(2014). Prevalence and antimicrobial susceptibility
of Staphylococcusaureus isolated from cattle, buffalo, sheep and goats raws milk in
Sohag Governorate, Egypt. Assiut. Vet. Med. J., 60: 63-72
42. Lee, YJ. ; Chen, JZ. ; Lin HC. ; Liu HY. ; Lin, SY. ;Lin HH. ; Fang CT. and Hsueh,
PR. (2015). Impact of active screening for Methicillin-Resistant Staphylococcus
aureus (MRSA) and decolonization on MRSA infections, mortality and medical cost:
A quasi-experimental study in surgical intensive care unit. Crit. Care, Vol. 19.
43. Vishnupriya, S. ; Antony, P. X. ; Mukhopadhyay, H. K. ; Pillai, R. M. ;
Thanislass, J. ; Vivek Srinivas, V. M. and Sumanth Kumar R (2014). Methicillin
resistant staphylococci associated with bovine mastitis and their zoonotic
importance. Veterinary World, 2231-0916. P422-427.
44. Buyukcangaz, E. ; Kahya, S. ; Sen, A. ; Seyrek, K. ; Eyigor, A. ; Temelli, S. and
Tayfun K. (2013).MecA Gene Prevalence in Staphylococcus aureus Isolates from
Dairy Cows in Turkey.J. Biol. Environ. Sci., 7(21), 183-190
45. Chandrasekaran, D. ; Venkatesan, P. ; Tirumurugaan, K. G. ; Nambi, A. P.;
Thirunavukkarasu, P. S. ; Kumanan, K. and Vairamuthu, S. (2014). A study on
Methicillin resistant Staphylococcus aureus mastitis in dairy cows. Journal of
Applied and Natural Science 6 (2): 356-361.
46. Rahimi, H. ; Saei,H.D. and Ahmadi,M. (2015). Nasal carriage of Staphylococcus
aureus: Frequency and antibiotic resistance in healthy ruminants. Jundishapur J.
Microbiol., Vol. 8, No. 10. 10.5812.
47. Sancak, B. (2000).Staphylococcus aureus methicillin resistance mechanisms.
Microbiol Bulletin. 34: 381-389.

  • تاريخ الاستلام 01 أيلول / سبتمبر 2016
  • تاريخ التعديل 01 كانون الثاني / يناير 1970
  • تاريخ القبول 30 تشرين الأول / أكتوبر 2016
  • تاريخ النشر 30 تشرين الثاني / نوفمبر 2016