Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
280
THE ASSOCIATION OF THE POLYMORPHISM AND GENE
EXPRESSION OF HEAT SHOCK PROTEIN HSP70 GENE IN
WINTER AND SUMMER IN THE SEMEN OF HOLSTEIN BULLS
BORN IN IRAQ
Hassan Nima Habib*, Bassam Yasein Khudaier**, Amad Falah Hassan*
and Wessam M M Saleh**
* College of Agriculture, University of Basrah, Basrah, Iraq
** College of Veterinary, Medicine University of Basrah, Basra, Iraq
Keywords; HSP70 protein, gene expression, polymorphisms.
Corresponding Author: fllan8@yahoo.com
ABSTRACT
The HSP70 protein considered as a molecular markers to resist various stress
conditions, especially high temperatures. Therefore, the high level of gene expression
of hsp70 gene is one of the ways to resist stress conditions, which can vary depending
on the polymorphisms. The study aimed to determine the extent of the correlation
between gene expression and polymorphisms to hsp70 gene. The study was conducted
in the months: November , December , 2015, January 2016, as the winter season and
the months April , May and June, 2016, as the summer season. Twenty nine Holstein
bulls born in Iraq of known fertility, 2.5 – 3.5 years old, back to Artificial
Insemination Center of Abou-Ghareeb Baghdad, Iraq, the General Company for
Livestock Services, Semen collected using artificial vagina method, mRNA
extraction, Synthesis of mRNA to cDNA and Real-Time Quantitative RT–qPCR were
done. The results showed significant differences in the level of gene expression
between polymorphisms to the hsp70 gene. In conclusion there is a positive
correlation between the gene expression and polymorphisms of hsp70 gene in
Holstein bulls born in Iraq .
INTRODUCTION
HSP70 is one of a component of sperm plasma in bulls and sheep (1,2), which
increases the secretion of the gonads in different stress situations (3), especially at
high temperatures(4). Several studies have shown that there is a significant difference
in the level of gene expression of hsp70 proteins between the summer and winter
seasons, as the rise in summer temperatures leads to an increase in the level of gene
expression of these proteins significantly (P <0.05) compared to the winter (5,6,7).
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
281
There is a positive correlation between the high level of gene expression of hsp 70
gene and the motility of sperm and percentage of live to dead and some characteristics
of semen (8,9). On the other hand, gene expression was associated with the genetic
factors that have a significant impact in determining the response of individuals to the
level of gene expression of hsp 70 (10,11), in addition, it is positively associated with
polymorphisms of hsp 70 gene (10). Perhaps one of the most important roles of hsp70
protein during stress conditions is its control over the process of reproducing different
proteins and post-transcription process of proteins correctly and control the
completion of the transcription process, hence, the high level of gene expression of
hsp70 in stress conditions is important to complete the process of protein replication
correctly (12). The effect of the high level of gene expression of hsp70 in semen
directly influences the subsequent development of embryos by improving the rate of
growth of the blastocyst (13,14). Therefor this study aimed to determine the
relationship between the polymorphism and the gene expression of the hsp70 gene in
the semen of Holstein bulls born in Iraq in the summer and winter seasons.
METHODS AND MATERIALS
Animals and semen collection
This study was conducted in the months: November , December , 2015, and
January 2016, as it was regard as the winter season and the months April , May and
June, 2016, as it was regard as the summer season. Twenty nine Holstein bulls born in
Iraq of known fertility, 2.5 – 3.5 years old, back to Artificial Insemination Center of
Abou-Ghareeb Baghdad, Iraq, the General Company for Livestock Services
(longitude 44.1922070, latitude 33.3095550 northwest of Baghdad) were used.
Semen collection
Semen collected from all bulls (mature and healthy) by using the artificial vagina
method twice a week, early in the morning.
mRNA extraction
RNA extraction was performed from semen samples (5 microliters) depending on the
method described by Zhang et al., (15), using hot TRIZOL method
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
282
Detection and Quantification of mRNA
The quantity and purity of RNA were measured using Thermo Scientific NanoDrop
2000 UV-Vis Spectrophotometer (Thermo Scientific, Fisher Scientific,
Loughborough, UK). The absorbance of 1μl of RNA at 260nm and 280nm was
determined. The purity of RNA was assessed by (A260/A280) ratio, which was above
1.81 for all samples.
Synthesis of mRNA to cDNA
Synthesis of mRNA to cDNA was performed through reverse transcription by reverse
transcriptase enzyme as described by Zhang et al., (15), according to the method
mentioned with kit (AccuPower® RocketScript™ RT PreMix) Bioneer company. The
cDNA synthesis was performed in a reaction volume of 20 μl. All reaction mixtures
were prepared with ice, the samples were then placed in a 96 Well Thermal Cycler,
and cycled at the conditions in (Table 1). The converted cDNA was stored at -20°C
and used as a template for PCR amplification. The obtained cDNA was diluted to a
final concentration of 25 ng/μl.
Table (1) Program used in cDNA synthesis (temperature and cycles)
Real-Time Quantitative RT–qPCR
This reaction was done according to the method described by Zhang et al., (15).
The SYBR® Premix kit was used, The β-actin gene was amplified as a housekeeping
control with primers mentioned in Table 2.
Temperature Cycle
(C°)
Step
Annealing primer °37 10 min
cDNA synthesis °60 60 min
Heat inactivation °95 5 min
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
283
The sample size was 10 microliters containing 6 μL SYBR Green (1x) and 0.5 μl
for both the forward and the reverse primer at 10 pCumol and 1 μl of cDNA at 100
ng and then the full volume (2 microliters) distilled water ddH2O. The RT qPCR
reaction condition explain in table 3.
Table (2) The primers used to amplify qRT-PCR
Table (3) The RT qPCR reaction condition
Temperature time Cycle
(C°)
Step
Pre-Denaturation °95 3 min 1
30
Denaturation °95 10 sec
Annealing °57 30 sec
Extension °72 30 sec
Final Extension °72 10 min 1
A calculation for estimating the efficiency (E) of a real-time PCR assay was
performed by Pfaffl (16) as follows :
Efficiency= 10-1/slope -1
First BASE
Laboratories
Malaysia
(2016)
5- ACCCAGCACAATGAAGATCAA -3 (F)
5- AACAGTCCGCCTAGAAGCATT -3 (R)
5- ATGGCGAAAAACATGGCTATCGGC -3 (F)
5- CTAATCCACCTCCTCAATGGTGGGGCC3 -3 (R)
β- actin
hs p70
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
284
The abundance ratio was calculated by the equation of the ‘Δ–Δ method’ described by
Livak and Schmittgen (17). This equation was used for comparing relative abundance
results between treatments in real-time PCR and as follows:
Abundance ratio = 2 –[ΔCT sample -ΔCT control
Abundance ratio = 2 –ΔΔCT
The CT raw data were obtained from BIONEER detection system and the calculations
were performed by Microsoft Excel®. The data were prepared for statistical analysis
(The winter season was adopted as a control group and the calculation of the general
average of the winter season and its comparison to the summer season).
The polymorphism of hsp70 gene
Adopted the haplotypes that describe by Habib et al., (18) as follows :
1- First group A (G1) 15 bulls
2- Second group B (G2) 6 bulls
3- Third group C (G3) 8 bulls
RESULTS AND DISCUSSION
The results showed a significant superiority in the level of gene expression of
hsp70 (fig 1) in the summer season compared to the winter season in all groups, in
general this results are consistent with those of Kumar et al., (19) indicating a
significant increase (P <0.05) in the level of gene expression in the summer season in
both cyahual, tharabacar and buffalo cattle. This increase is to enhance the resistance
of heat stress caused by high temperature And humidity, hsp70 gene is one of the
most important genes responsible for the tolerance of various stress conditions that
directly affect reproduction in the Holstein bulls (20), it consider as a molecular
markers to the heat tolerance(21). On the other hands the bulls in the second group
genotype B (G2) showed Significantly higher (P < 0.05) than genotype C and A
in the level of gene expression of heat shock protein hsp70 gene in the summer
season. This superiority Significantly gives an impression of how stable the sperm
cells are, Increasing the level of expression of hsp70 positively correlates with sperm
cell stability (22), it greatly reduces the effect of heat stress (23), So it has an effective
contribution to the survival of cells and living organisms (24, 25), thus it is positively
associated with sperm motility (15) and other Characteristics of semen (26). The
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
285
most important roles played by the HSP70 with the help of HSP40 proteins is to
increase the efficiency of metabolism under different stress conditions as they act
directly or indirectly as molecular Chaperone to enhance the utilization of cells from
the metabolism under different stress conditions, also reduces apoptosis in the event
that the level of gene expression increases in the semen of mammals (27,28). The
differences between the polymorphisms of hsp70 gene may be a sign of the difference
in the possibility of tolerance of different stress conditions (especially heat stress) for
individuals within a same breed, it has a high heritability to their offspring (29).
The level of gene expression of hsp70 gene polymorphism in both summer and winter
seasons
The horizontal letters mean t hat there were significant differences at (P <0.05)
CONCLUSION
This study showed a correlation between the hsp70 gene polymorphism and gene
expression in semen of Holstein bulls born in Iraq, gene expression differed in
different polymorphism. This link may be refers to the ability of this breed to modify
its genes to resist the various environmental changes without any impact on its
production.
REFERENCES
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
286
1- Moura, A.A. ; Souza, C.E.A. ; Stanley, B.A. ; Chapman, D.A.and
Killian, G.J. ( 2010). Proteomics of cauda epididymal fluid
from mature Holstein bulls. J.Proteomics, 73 (10): 2006–2020.
2- Souza, C.E.A. ; Rego, J.P. ; Lobo, C.H. ; Oliveira, J.T.A. ; Nogueira, F.C. ;
Domont, G.B. ; Fioramonte, M. ; Gozzo, F.C. ; Moreno,
F.B. ; Monteiro-Moreira, A.C. ; Figueiredo, J.R. and Moura,
A.A. ( 2012). Proteomic analysis of the reproductive tract
fluids from tropically-adapted Santa Ines rams. J. Proteomics 75
(14):4436–4456.
3- Chan, C. C. ; Sun, G. H. ; Shui, H. A. and Wu, G.J. (2013). Differential
spermatozoal protein expression profiles in men with varicocele
compared to control subjects: upregulation of heat shock proteins 70 and
90 in varicocele. Urology, 81(6) : 1379.e1-8.
4- Parmar, M.S. ; Madan, A.K. ; Huozha, R. ; Rastogi, S.K. and Mili, B. (2015).
Heat Shock Protein70 (HSP70) Gene Expression Pattern in Peripheral
Blood Mononuclear Cells (PBMCs) during different Seasons in
Sahiwal Cows (Bos Indicus. Journal of Animal Research, 5 (1): 109-
113.
5- Mishra, A. ; Hooda, O.K. ; Singh, G. and Meur, S.K. (2011). Influence of
induced heat stress on HSP70 in buffalo lymphocytes. J. Anim. Physiol.
Anim. Nutr., 95 (4): 540 –544.
6- Sharma, S. ; Ramesh, K. ; Hyder, I. ; Uniyal, S. ; Yadav, V.P. ; Panda, R.P. ;
Maurya, V.P. ; Singh, G. ; Kumar, P. ; Mitra, A. and Sarkar, M. (2013).
Effect of melatonin administration on thyroid hormones, cortisol and
expression profile of heat shock proteins in goats (Capra hircus) exposed to
heat stress. Small Rumin. Res., 112(1):: 216–223.
7- Pawar, N.H. ; Agrawal, R.K. ; Ramneek and Brah, G.S. (2013). Expression,
purification and characterization of recombinant Heat Shock Protein
70 (HSP70) from sheep and goat species.
Int.J.Curr.Microbiol.App.Sci., 2(11): 440-452.
8- Rajoriya, J. S. ; Prasad, J. K. ; Ghosh, S. K. ; Peruma , P. ; Anuj, K. ;
Kausha, S. ; Ramteke, S. S.( 2014). Studies on effect of different
seasons on expression of HSP70 and HSP90 gene in sperm of
Tharparkar bull semen. Asian Pacific Journal of Reproduction, (3):
192-199.
9- Dangi, S.S. ; Gupta, M. ; Nagar, V. ;Yadav, V.P. ; Dangi, S.K. ; Shankar, O. ;
Chouhan, V.S. ; Kumar, P. ; Singh, G. and Sarkar. M. (2014). Impact
of short-term heat stress on physiological responses and expression
profile of HSPs in Barbari goats. Int. J. Biometeorol., 58(10): 2085–2093.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
287
10- Maugeri, N. ; Radhakrishnan, J. and Knight, J.C. (2010). Genetic
determinants of HSP70 gene expression following heat shock. Human
Molecular Genetics, 19(24): 4939-4947.
11- Singh, A.K. ; Upadhyay, R.C. ; Malakar, D. ; Kumar, S. and Singh, S.V.
(2014). Effect of thermal stress on HSP70 expression in dermal fibroblast of
zebu (Tharparkar) and crossbred (Karan-Fries) cattle. Journal of Thermal
Biology, 43 : 6–53.
12- Chin, P.Y. ; Macpherson, A.M. ; Thompson, J.G. ; Lane, M. and Robertson,
S.A.(2009). Stress response genes are suppressed in mouse
preimplantation embryos by granulocyte-macrophage colony-stimulating
factor (GM-CSF). Hum. Reprod., 24(12):2997 – 3009.
13- Marei, W.F. ; Raheem, K.A. ; Salavati, M. ; Tremaine, T. ; Khalid, M. and
Fouladi-Nashta, A.A. (2016). Hyaluronan and hyaluronidase, which is
better for embryo development? Theriogenology, 86 (4) : 940–948.
doi:10.1016/j. theriogenology.2016.03.017.
14- Wen, Z. ; Pan, Y. ; Cui, Y. ; Peng, X. ; Chen, P. ; Fan, J. ; Li, G. ; Zhao, T. ;
Zhang, J. ; Qin, S. and Yu, S. (2017). Colony-stimulating factor 2
enhances the developmental competence of yak (Poephagus grunniens)
preimplantation embryos by modulating the expression of heat shock
protein 70 kDa 1A. Theriogenology, 93 (2017) 16 – 23.
15- Zhang, X.G. ; Hong, J.Y. ; Yan, G.J. ; Wang, Y.F. ; Li, Q.W. and Hu, J.H.
(2015). Association of heat shock protein 70 with motility of frozen-thawed
sperm in bulls. Czech J. Anim. Sci., 60 (6):256–262.
16- Pfaffl, M. W. (2001). A new mathematical model for relative quantification in realtime
RT–PCR. Nucleic acids research 29(9): e45-e45.
17- Livak, K. J. & Schmittgen, T. D. (2001). Analysis of relative gene expression
data using real-time quantitative PCR and the 2− ΔΔCT method. methods
25(4): 402-408.
18- Habib, H.N. ; Hassan, A.F. and Khudaier, B.Y.(2017). Molecular Detection of
Polymorphism of Heat Shock Protein 70 (hsp70) in the semen of Iraqi
Holstein Bulls. Asian J. Anim. Sci., 11(3): 132-139.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
288
19- Kumar, R. ; Gupta, I.D. ; Verma, A. ; Verma, N. ; Magotra, A. and Vineeth,
M.R. (2015b). Molecular characterization and polymorphism detection in
HSPB6 gene in Sahiwal cattle. Indian J. Anim. Res., 49 (5) : 595-598.
20- El-Tarabany, M.S. and Nasr, M.A.F. (2015). Reproductive performance of
Brown Swiss, Holstein and their crosses under subtropical
environmental conditions. Theriogenology, 84 (4) : 559-565.
21- Manjari, P. ; Yadav, M. and Ramesh,K. (2015). HSP70 as a marker of heat and
humidity stress in Tarai buffalo. Trop Anim Health Prod., 47(1) :111–
116.
22- Pribenszky, C. ; Kuo, Y.K. and Huang, S.Y. (2012). The Effect of Hydrostatic
Pressure Treatment on the Levels of HSP90 and HSP70 in Boar
Spermatozoa before and after Freezing. J. Agri. & Fore., 61(3): 265-280.
23- Cheng, Y. ; Liu, S. ; Zhang, Y. ; Su, D. ; Wang, G. ; Lv, C. ; Zhang, Y. ; Yu,
H. ; Hao , L. and Zhang, J. (2016). The effect of heat stress on bull
sperm quality and related HSPs expression. Animal Biology,(66): 321–
333. doi 10.1163/15707563-00002507.
24- Kishore, A. ; Sodhi, M. ; Sharma, A. ; Shandilya, U.K. ; Mohanty, A. and
Verma, P. (2016). Transcriptional stability of heat shock protein genes
and cell proliferation rate provides an evidence of superior cellular
tolerance of Sahiwal (Bos indicus ) cow PBMCs to summer stress. J. Vet.
Sci., 2: 34-40.
25- Shaji, S. ; Sejian, V. ; Bagath, M. ; Mech, A. ; David, I.C.G. ; Kurien E.K. ;
Varma, G. and Bhatta, R. (2016). Adaptive capability as indicated by
behavioral and physiological responses, plasma HSP70 level and PBMC
HSP70 mRNA expression in Osmanabadi goats subjected to combined (heat
and nutritional) stressors. Int. J. Biometeorol, 60(9):1311–1323.
26- Kumar, A. ; Singh, j. ; Kumar, R.G.V. ; Cheema, R.S. ; Andey, A.K. ; Singh,
P.; Ghuman, S.P.S. ; Brar, P.S. and Gandotra, V.K. (2016).
Prediction of buffalo bull fertility on the basis of sperm motion traits,
viability, membrane integrity, heat shock protein (HSP70) expression
and fertility associated antigen (FAA). Indian Journal of Animal
Sciences, 86 (6): 648–654.
27- Anglès, F. ; Castanié-Cornet, M.P. ; Slama, N. ; Dinclaux, M. ; Cirinesi,
A.M., ; Portais, J.C. ; Létisse, F. and Genevaux, P. (2017). Multilevel
interaction of the DnaK/DnaJ(HSP70/HSP40) stress-responsive
chaperone machine with the central metabolism. Scientific Reports, 7.
doi.org/10.1038/srep41341.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
289
28- Capra, E. ; Turri, F. ; Lazzari, B. ; Cremonesi, P. ; Gliozzi, T.M. ; Fojadelli,
I. ; Stella, A. and Pizzi, F. (2017). Small RNA sequencing of
cryopreservedsemen from single bull revealed alteredmiRNAs and
piRNAs expression betweenHigh- and Low-motile sperm populations l.
BMC Genomics, 18(1):14 doi 10.1186/s12864-016-3394-7.
29- Kesorn, P. ; Lee, J.W. ; Wu, H.Y. ; , Ju, J.C. ; Peng, S.Y. ; Liu, S.S. ; Wu,
H.H. and Shen, P.C. (2017). Cellular thermotolerance is inheritable
from Holstein cattle cloned with ooplasts of Taiwan native yellow cattle.
Theriogenology, 15(88) : 244-253. doi:
10.1016/j.theriogenology.09.030.