Document Type : Research Paper
Authors
Department of microbiology, College of Veterinary Medicine, University of Basrah, Iraq
Abstract
This study was aimed to detect the presence of Escherichia coli in frozen meat. A total of
200 samples were collected from Basrah markets in the period extending from September
2015 to March 2016. These samples were composed of 50 frozen fish samples, 50 frozen
burger samples, 50 frozen chicken samples and(50) worker's hands swabs. Different
techniques were used in this study to evaluate the presence of Escherichia coli which
contaminate the frozen meat, these techniques included the traditional bacteriological assays,
commercial identification kit (API 20 E) and molecular techniques (PCR). Results of these
techniques indicated 25 (12.5%) samples were positive to Escherichia coli , as identified by
API 20 E system. The results of 25 isolates of Escherichia coli which confirmed by PCR,
These isolates were subjected to PCR [sta gene, stb gene, lt gene and uspA gene]. The results
PCR confirmed only 16 of these isolates contain sta gene and 5 of these isolates contain uspA
gene ,While isolates do not contain the gene stb or lt genes.
Keywords
Article Title [العربیة]
الکشف عن جینات الضراوة فی جرثومة الاشریشیا القولونیة المعزولة من اللحوم المجمدة فی أسواق البصرة
Authors [العربیة]
- باسل عبد الزھرة عباس
- علا ماجد الغانم
فرع الاحیاء المجھریة ،کلیة الطب البیطری ،جامعة البصرة ،البصرة ، العراق
Abstract [العربیة]
تم من خلال ھذه الدراسة الکشف عن وجود جرثومة الاشریشیا القولونیة فی اللحوم المجمدة .تم جمع 200 عینة من
. اسواق البصرة للفترة من شھر ایلول 2015 لغایة شھر اذار 2016
العینات التی تم اخذھا تکونت من 50 عینة من السمک المجمد، 50 عینة من البرغر المجمدة ، 50 عینة من الدجاج المجمد
و 50 مسحة من ایدی العاملین .
کما تم استخدام تقنیات مختلفة فی ھذه الدراسة لتقییم وجود الاشریشیا القولونیة التی تلوث اللحوم المجمدة ، وھذه
التجاری والتقنیات الجزیئیة (تفاعل البلمرة API (20 E ) التقنیات تشمل الاختبارات البکتریولوجیة التقلیدیة ، عدة
المتعدد). تشیر نتائج ھذه التقنیات إلى وجود 25 عزلة من اصل 200 أی بنسبة 12,5 % من الای کولای باستخدام
. اختبارات API 20 E
أکدت نتائج تفاعل البلمرة .(uspA وجین lt وجین ،stb و جین sta خضعت ھذه العزلات لتفاعل البلمرة المتعدد (جین
بینما لا تحتوی uspA و 5 عزلات تحتوی على جین sta المتعدد ان فقط 16 عزلة من ھذه العزلات تحتوی على جین
. lt ولا تحتوی ایضا على جین stb
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
134
DETECTION OF VIRULENCE GENES IN ESCHERICHIA COLI
ISOLATED FROM FROZEN MEAT IN BASRAH MARKET
Basil A. Abbas , Aula M. Alghanim
Department of microbiology, College of Veterinary Medicine, University of Basrah, Iraq
Keywords; Escherichia coli, frozen meat, PCR
ABSTRACT
This study was aimed to detect the presence of Escherichia coli in frozen meat. A total of
200 samples were collected from Basrah markets in the period extending from September
2015 to March 2016. These samples were composed of 50 frozen fish samples, 50 frozen
burger samples, 50 frozen chicken samples and(50) worker's hands swabs. Different
techniques were used in this study to evaluate the presence of Escherichia coli which
contaminate the frozen meat, these techniques included the traditional bacteriological assays,
commercial identification kit (API 20 E) and molecular techniques (PCR). Results of these
techniques indicated 25 (12.5%) samples were positive to Escherichia coli , as identified by
API 20 E system. The results of 25 isolates of Escherichia coli which confirmed by PCR,
These isolates were subjected to PCR [sta gene, stb gene, lt gene and uspA gene]. The results
PCR confirmed only 16 of these isolates contain sta gene and 5 of these isolates contain uspA
gene ,While isolates do not contain the gene stb or lt genes.
INTRODUCTION
Raw meat has enriched nutrient composition with water activity ranged from 0.98 to
0.99 and pH ranging from 5.5 to 6.5, and all of these properties support the growth of most
contaminating microorganisms [1]. Contamination of raw meat is one of the main sources of
foodborne diseases [2]. Unfortunately, the presence of microbs contaminants in meat products
cannot be detected visually [3], this increases the risks associated with foodborne microbs and
the incidence of human illnesses [4]. The two primary kinds of bacteria which are of
consequence are pathogenic bacteria and spoilage bacteria. Spoilage bacteria are generally not
harmful, but they will cause food to deteriorate or lose quality by developing a bad odor or
texture. Pathogenic bacteria are those such as Salmonella, Escherichia coli O157:H7,
Campylobacter jejuni, Listeria monocytogenes, and Staphylococcus aureus, all which cause
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
135
food-borne illness and cannot be seen or smelled [5]. E. coli is known to affect the synthesis of
vitamin K in the host. Certain E. coli strains might also serve as an important factor for
inhibition of the growth of enteropathogens [6]. Moreover, E. coli is also capable of surviving
in the environment, water, and food, and spreading efficiently [7].Thousands of serotypes of E.
coli species, in the Escherichia genus, within the family of Enterobacteriaceae, form the
intestinal bacterial group described as gram negative, non-sporulating facultative anaerobic
rod, usually motile by peritrichous flagella [8]. Pathogenic E. coli that do not belong to the
normal microbiota, harbor virulence factors, such as adhesions, invasins, entero- and
cytotoxins encoded by extrachromosomal plasmids, chromosomal pathogenicity islands, or
bacteriophage integrated virulence factors for defeating host defences in order to cause
intestinal and extra-intestinal diseases [9].
MATERIALS AND ETHODS
Samples collection:
The samples were collected from different local markets in Basrah city . A total of 200
samples were collected in the period extending from September 2015 to March 2016,
including 50 samples of each frozen burger, frozen chicken frozen fish and worker's hands.
Isolation of bacteria :
The samples were collected in a sterile containers and immediately transported inside ice
box to the laboratory for bacteriological analysis. The basal medium is trypticase soy broth
(TSB) supplemented with (1.5 g) bile salt and dipotassium hydrogen phosphate for each was
adjusted at PH 7.4±2 after autoclaved and cooled to 56 °C in water bath,Vancomycin (4 mg/L)
were added. The medium was used to enhance the growth of E. coli and partially inhibit
other bacteria [10]. Tubes were incubated at 37°C for 18 hrs. After enrichment period of
samples, a loopfull of bacterial growth from the TSB-V broth was transferred and streaked on
the surface of EMB and MacConkey agar then incubated overnight to identify lactose
fermentation and metallic sheen appearence . Typical colonies on MacConkey agar and EMB
were streaked on the surface of MacConkey sorbitol agar which was composed of 1% sorbitol
instead of lactose in standard MacConkey agar, this medium was also supplemented with
cefixime 0.05mg/L, potassium tellurite 2.5mg/L to be used as selective medium and
incubated for additional overnight to identify non sorbitol fermented E. coli (NSFEC).The
colonies of EHEC grown on SMA-CT are small, circular and colorless [11].
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
136
Identification : All suspected colonies on MacConkey agar and EMB were streaked on the
surface of pre-dried nutrient agar plates, in a manner which allowed well isolated colonies to
develop. The inculcated plates were incubated at 37C˚ for 24 hrs. Thus, the pure colonies
obtained was used for primary identification by biochemical tests such as indole test , triples
sugar iron (TSI), citrate test and, oxidase test.
API 20 E
Further confirmations were done by using API 20E test kit (BioMérieux, Inc., France).
The plastic strips holding twenty mini-test tubes were inoculated with the saline suspensions
of the cultures according to manufacturer's directions. This process also rehydrated the
desiccated medium in each tube. A few tubes were completely filled (CIT,VP and GEL), and
some tubes were overlaid with mineral oil for anaerobic reactions (ADH, LDC, ODC, H2S,
URE). After incubation in a humid chamber for 18-24 hrs at 37°C, the colour reactions were
read (some with the aid of added reagents as supplied by the kit). The data were analyzed by
the manufacturer’s software [12].
PCR analysis
Extraction of bacterial DNA: This procedure was done by using commercially available
DNA extraction and purification kit (Geneaid, Korea).
Preparing the Primers.
Oligonucleotide primers were prepared depending on manufacturer instruction.
Sequence of priers were listed in table 1.
The electrophoresis of amplified product was carried out in (1.5)% agarose gel using
(7)μl DNA ladder as molecular weight marker and (7)μl of PCR reactions at (70)V for (30)
min then at (80)V for (20) min. The gel was visualized by UV transilluminator then
photographed.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
137
Table: 1. Oligonucleotide primers for PCR amplification
Reference
P
(bp)
L
(bp)
Primer Sequence (5´→ 3΄ )
S
Nguyen et
al.,2009
183
24
GGGTTGGCAATTTTTATTTCTGTA
F
sta
gene R ATTACAACAAAGTTCACAGCAGTA 24
Nguyen et
al.,2009
360
24
F ATGTAAATACCTACAACGGGTGAT
stb
gene
R TATTTGGGCGCCAAAGCATGCTCC 24
Nguyen et
al.,2009
282
F TAGAGACCGGTATTACAGAAATCTGA 26
lt gene
R TCATCCCGAATTCTGTTATATATGTC 26
Chen&Gri
ffitha
1998
884
F CCGATACGCTGCCAATCAGT 20
uspA
gene R ACGCAGACCGTAGGCCAGAT 20
L: Length of primers; S: Specifity; P: Product size
RESULTS
Isolation and characterization
The growing colonies on Eosen-methylene blue (EMB) agar had green metallic sheen
appearance and constituted 25 (12.5%) out of 200 samples. On MacConkey agar, the growing
colonies were two types, lactose fermenting and non-lactose fermenter. The isolates of lactose
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
138
fermenting produced pink to red colonies. While the non-lactose fermenting, produced
colorless colonies. The suspected colonies of EHEC on macConkey sorbitol agar were small,
circular and colorless with smoky center (1-2) mm in diameter.
Results of conventional biochemical tests
Specific biochemical tests were used for the detection of lactose fermenting and nonlactose
fermenting isolates on MacConkey agar .These biochemical tests were TSI test, citrate
utilization, Indole test, oxidase test and urease activity (table 2).
Table (2) Comparison of the isolates according to the conventional biochemical results.
Biochemical
tests
Results
No. of results
of lactose
fermenting
No. of results
of non-lactose
fermenting
TSI test Positive 25 47
negative 0 0
Urease test Positive 0 18
negative 25 29
Simmon's
citrate
Positive 0 47
negative 25 0
Oxidase test Positive 0 47
negative 25 0
Results of using API 20 E in identification
Using of API 20 E system revealed that25(12.5%) of isolates were identified as E coli
(table 3).
Table (3) Distribution of E. coli according to API 20 E.
Sample No. of
examined
samples.
No. of positive % of Positive
Frozen fish 10 10 100
Frozen burger 7 7 100
Basrah Journal of Veterinary Research,Vol.
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
Frozen chicken
Worker's hand
Molecular identification
A total of (25) of isolates which were identified
extraction. PCR assay for the presence of
(Figure 2) ,While stb gene (570bp) and
Figure (1): PCR amplification mixture was run on 1.5% agarose gel stained with ethidium
bromide. Lanes: M, Marker. 1,4 and 6 positive for
200 bp
100 bp
M 1
900bp
800bp
700bp
600bp
500bp
M 1
15, No.3,2016
139
8 8
0 0
by API 20 E were subjected to DNA
sta gene (183bp) (Figure 1
lt gene (516bp) not present in any isolates.
): sta gene (183bp) of
2 3 4 5 6
2 3 4 5
100
0
1) , uspA gene (883bp)
E.coli.
183 bp
7
883 bp
6
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
140
Figure (2): PCR amplification mixture was run on 1 % agarose gel stained with ethidium
bromide. Lanes: M, Marker. 3 and 4 positive for uspA gene (883bp) as E.coli.
Distribution of E. coli in tested samples according to PCR results.
According to PCR results out of (25) examined isolates, the positive PCR results were
observed in 16 isolates (64%) according to PCR assay using sta gene, 5 isolates (20%)
according to PCR assay using uspA gene , no isolates (0%) according to PCR assay using stb
gene and no isolates (0%) according to PCR assay using lt gene (Table 4) .
Table (4): Molecular identification of sta gene from E. coli isolated from studied
sampled.
Sample No. of
examined
samples
Sta
positive
(%)
UspA
positive
(%)
stb
positive
(%)
Lt
positive
(%)
Frozen
fish
10 4(40) 1(10) 0(0) 0(0)
Frozen
burger
7 7(100) 3(42) 0(0) 0(0)
Frozen
chicken
8 5(62.5) 1(12.5) 0(0) 0(0)
Worker's
hand
0 0(0) 0(0) 0(0) 0(0)
Total 25 16(64) 5(20) 0(0) 0(0)
DISCUSSION
Food spoilage can be considered as any change, which renders a product unacceptable for
human consumption [13].The conventional methods used for E. coli detection relies on
enrichment the samples in enrichment trypticase soy broth Vancomycin (TSB-V) Medium,
followed by culturing on selective media on eosen-methylene blue (EMB) agar, then
differentiating on MacConkey agar, MacConkey sorbitol agar and submitting to biochemical
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
141
confirmation. Enrichment time allows the target E. coli to multiply until reaching a detectable
concentration by the conventional and PCR methods. Moreover, after pre enrichment, the
number of the dead cells becomes negligible, thus overcoming the problem of the inability of
PCR to distinguish between living and dead organisms [14].By culturing the samples on
eosen-methylene blue (EMB) agar, the colonies were give a distinctive metallic green sheen
and constitute 12.5% (25/200). On EMB agar the form of the colonies were metallic green
sheen , therefore, in order to differentiate between them have been cultured on MacConkey
agar because this media is differentiated between lactose fermenting and lactose nonfermenting
bacteria also lactose fermenting test, it is not part of the API 20 E tests. However,
[15]report that, so the colony morphology Lactose fermenter; Flat, dry, pink colonies with a
surrounding darker pink area of precipitated bile salts. E. coli strain will produce indole from
tryptophan; it does not produce hydrogen sulfide, urease, and cannot use citrate as sole carbon
source [16].
All these samples were also examined for the presence or absence of E. coli O157:H7.
plated onto SMAC-CT agar and finally confirmed by PCR [17].The isolates of EHEC
O157:H7constitutes 16% (4/25). This is in agreement with [17]who examined 1303 Of the
samples for beef burger,43 contained E. coli O157:H7.
After staining with Gram stain , the isolates were submitted to conventional biochemical
tests , further, the confirmation of the presumptive isolates was carried out with a commercial
bacterial identification kit such as the Analytical Profile Index (API) system. This is in
agreement with [18]who noted that, the API-20E is a miniaturized panel of biochemical tests
compiled for the identification of groups of closely related bacteria .
The results of conventional biochemical tests had similar to the results of API 20 E. The
API 20 E results were revealed 12.5% (25/200) of isolates which were identified as E. coli. In
this study is in agreement with [19]who isolated E.coli from frozen meat in ratio (44%).
The isolation rate of E.coli from frozen beef burger samples was (14%)(7/50), this result is
in line with [20]who found E.coli from this type of samples.
The present of E. coli in frozen meat may be constitute a danger for worker and consumers,
this point in agreement with [19]who reported that pathogenic E .coli O157:H7 present
potential hazard to human health due to the ability of E. coli O157:H7 to survive in frozen
beef meat.
In this study four methods (conventional, API 20E and molecular ) were used to detect E.
coli. and related genera in raw meat and abattoir environment. The results of this study were
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
142
indicated that, the total number of suspected E. coli identified by conventional techniques was
25/200 (12.5%), while API 20E system results indicate that all the 25 isolates were identified
as E. coli, however by molecular identification was 16/200(8%) as E. coli by using sta gene
and 5/200(2.5%) by using uspA gene.
Molecular tests have been designed for the detection of many virulence genes and are often
the most sensitive methods for detecting them. The primer pairs used in the PCR were
designed according to the nucleotide sequences of the four genes. The first primer pair, sta -F
and Sta -R of the sta gene [21]will amplify and produce a double-stranded fragment of 183 bp.
The second primer pair, stb -F and stb -R of the stb gene[21]will amplify and produce a
double-stranded fragment of 360 bp. The third primer pair lt-F and lt-R, of the lt gene [21]will
amplify and produce a double-stranded fragment of 282 bp . The fourth primer pair uspA-F
and uspA -R, of the uspA gene [22]will amplify and produce a double-stranded fragment of
884 bp .
In this study, the isolation rate of E .coli 16/25(64%) , by sta gene, this result is in agreement
with [23]who found sta gene in 40% of E .coli isolates.
However in this study, the isolation rate of E.coli was 5/25(20%) by uspA gene this result is
less than [24]who found uspA gene in 92% of isolates .while the stb gene and lt gene were
absent in other E .coli. this result is in agreement with [25].
الکشف عن جینات الضراوة فی جرثومة الاشریشیا القولونیة المعزولة من اللحوم المجمدة فی أسواق
البصرة
باسل عبد الزھرة عباس ،علا ماجد الغانم
فرع الاحیاء المجھریة ،کلیة الطب البیطری ،جامعة البصرة ،البصرة ، العراق
تم من خلال ھذه الدراسة الکشف عن وجود جرثومة الاشریشیا القولونیة فی اللحوم المجمدة .تم جمع 200 عینة من
. اسواق البصرة للفترة من شھر ایلول 2015 لغایة شھر اذار 2016
العینات التی تم اخذھا تکونت من 50 عینة من السمک المجمد، 50 عینة من البرغر المجمدة ، 50 عینة من الدجاج المجمد
و 50 مسحة من ایدی العاملین .
کما تم استخدام تقنیات مختلفة فی ھذه الدراسة لتقییم وجود الاشریشیا القولونیة التی تلوث اللحوم المجمدة ، وھذه
التجاری والتقنیات الجزیئیة (تفاعل البلمرة API (20 E ) التقنیات تشمل الاختبارات البکتریولوجیة التقلیدیة ، عدة
المتعدد). تشیر نتائج ھذه التقنیات إلى وجود 25 عزلة من اصل 200 أی بنسبة 12,5 % من الای کولای باستخدام
. API 20 E اختبارات
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
143
وأکدت نتائج تفاعل البلمرة .(uspA وجین lt وجین ،stb و جین sta خضعت ھذه العزلات لتفاعل البلمرة المتعدد (جین
بینما لا تحتوی uspA و 5 عزلات تحتوی على جین sta المتعدد ان فقط 16 عزلة من ھذه العزلات تحتوی على جین
. lt ولا تحتوی ایضا على جین stb العزلات على جین
REFERENCES
1. Acuff, G. (2005). “Chemical decontamination strategies for meat”. Cited by Sofos, J.
(2005). Improving the safety of fresh meat. Boca Raton, FL: CRC Press., Pp: 350-363.
2. Podpecan, B.; Pengov, A. and Vadnjal, S .(2007). The source of contamination of
ground meat for production of meat products with bacteria Staphylococccus aureus.
Slov. Vet. Res., 44: 24-30.
3. Movassagh, M. H.; Shakoori, M. and Zolfaghari, J. (2010). The prevalence of
Salmonella spp. In Bovine carcass at Tabriz slaughterhouse, Iran. Global
Veterinaria.,5(2):146-149.
4. Ateba, C. and Mochaiwa, B. (2014). Use of invA gene specific PCR analysis for the
detection of virulent Salmonella species in beef products in the north west province,
South Africa. Journal of Food and Nutrition Research ., 2(6): 294-300.
5. International Commission on Microbiological Specifications for Foods.(1996).
Microorganisms in foods 5. Characteristics of microbial pathogens. ICMSF,
International Union of Biological Societies. Blackie Academic & Professional,
London, England.
6. Kruis, W. (2004). Review article: antibiotics and probiotics in inflammatory bowel
disease. Aliment. Pharmacol. Ther, 20 ( 4): 75-78.
7. Faiella-Tommasino, J. and Reigert, H. (2002). E. coli O157:H7–An Emerging
bacterial threat. Clin. Rev., 12: 47-53.
8. Scheutz, F. and Strockbine, NA. (2005). Genus I. Escherichia. In: Brenner, DJ.
(Eds.) The Protebacteria Part B The Gamma proteobacteria. Springer Bergey's Manual
of Systematic Bacteriology., 2 Part B:607-623.
9. Kaper, J. B.; Nataro, J. P. and Mobley, H. L. T. (2004). Pathogenic Escherichia
coli. Natu. Rev. Microbiol., 2: 123-140.
10. LeJeune, JT. ; Besser, TE. ; Rice, DH. and Itancock, DD. (2001). Methods for the
isolation of waterborne Escherichia coli O157:H7. Lett. Appl. Microbiol. , 32, 316–
320.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
144
11. Vincent, NC. ; Veronica, JU. ; Stella, IS. ; Etinosa , OI. and Anthony, IO. ( 2010).
Multidrug resistance and plasmid patterns of Escherichia coli O157 and other E. coli
isolated from diarrhoeal stools and surface waters from some selected sources in Zaria,
Nigeria. Int. J. Environ. Res. Pub. Health., 7:3831-3841 .
12. Imen, B.; Ridha, M. and Mahjoub, A. (2012). Laboratory typing methods for
diagnostic of Salmonella strains, the “old” organism that continued challenges,
Salmonella a dangerous foodborne pathogen.Infect Immun., 57: 3159- 3164.
13. Hayes, P. R. (1985). Food Microbiology and Hygiene. Elsevier, London., pp: 80 - 139.
14. Croci, L.; Delibato, E.; Volpe, G.; De Medici, D. and Palleschi, G. (2004).
Comparison of PCR, Electrochemical Enzyme - Linked Immuno Sorbant Assays and
the standard culture method for detection Salmonella in meat products . Appl. Environ.
Microbiol., 70(3): 1393-1396.
15. Mahon, A.R.; Barnes, M.A.; Senapati, S.; Feder, J.L.; Darling ,J.A. and et al.
(2011). Molecular Detection of Invasive Species in Heterogeneous Mixtures Using a
Microfluidic Carbon Nanotube Platform. PLoS ONE.,6(2):e17280–1-5.
16. Mahon, CR. ; Lehman, DC. and Manuselis, G. (2007). Textbook of diagnostic .3rd
Ed., St. Louis: Saunders., Pp: 215-216.
17. Cagney, C.; Crowley, H.; Duffy, G.; Sheridan, J.J.; O’Brien, S.; Carney, E.;
Anderson, W.; McDowell, D.A.; Blair, I.S. and Bishop, R.H.(2004). Prevalence
and numbers of Escherichia coli O157: H7 in minced beef and beef burgers from
butcher shops and super-markets in the Republic of Ireland. Food Microbiol., 21:203-
212.
18. Modarressi, S. and Thong, K. (2010). Isolation and molecular sub typing of
Salmonella enterica from chicken, beef and street foods in Malaysia. Scientific
Research and Essays., 5(18): 2713-2720.
19. Abuelhassan, N.N.; Abdul Mutalib, S.; Muin, N.M.; Tibin, E.M.M.; Doni, F. And
Yusoff, W.M.W. (2014). Antibiotic Resistance Pattern Among Escherichia Coli
O157:H7 Isolated From Retail Imported Frozen Meat. Asian Jr. of Microbiol. Biotech.
Env. Sc., 16 (3) : 739-744.
20. Stanford, K.; Agopsowicz, C.A. and McAllister, T.A. (2012). Genetic diversity and
antimicrobial resistance among isolates of Escherichia coli O157: H7 from feces and
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
145
hides of super-shedders and low-shedding pen-mates in two commercial beef feedlots.
BMC. Vet. Res.,8:178.
21. Nguyen, T. L.; Truong, H. T. and Nguyen, V. G. (2009). Determining virulence
factors of Escherichia coli strains isolated from diarrhea piglets by using PCR method.
J. Sci. Dev. ,7(2): 187 - 191.
22. Chen, J. and Griffiths, M.W. (1998). PCR differentiation of Escherichia coli from
other Gramnegative bacteria using primers derived from the nucleotide sequences
flanking the gene encoding the universal stress protein. Letters in Applied
Microbiology, 27: 369-371.
23. Macedo, N.R.; Menezes, C.P.L.; Lage, A.P.; Ristow, L.E.; Reis, A. and Guedes,
R.M.C. (2007). Detecção de cepas patogênicas pela PCR multiplex e avaliação da
sensibilidade. Arq. Bras. Med. Vet. Zootec. Belo Horizonte., 59 (5).
24. Osek, J. (2001). Multiplex polymerase chain reaction assay for identification of
enterotoxigenic Escherichia coli strains. J. Vet. Diagn. Investig., 13:308-311.
25. Fasina,F.O.; Bwala, D.G and Madoroba, E.(2015). Investigation of multidrugresistant
fatal colisepticaemia in weanling pigs. Onderstepoort j. vet. res.,82(1):6.
(2005). Improving the safety of fresh meat. Boca Raton, FL: CRC Press., Pp: 350-363.
2. Podpecan, B.; Pengov, A. and Vadnjal, S .(2007). The source of contamination of
ground meat for production of meat products with bacteria Staphylococccus aureus.
Slov. Vet. Res., 44: 24-30.
3. Movassagh, M. H.; Shakoori, M. and Zolfaghari, J. (2010). The prevalence of
Salmonella spp. In Bovine carcass at Tabriz slaughterhouse, Iran. Global
Veterinaria.,5(2):146-149.
4. Ateba, C. and Mochaiwa, B. (2014). Use of invA gene specific PCR analysis for the
detection of virulent Salmonella species in beef products in the north west province,
South Africa. Journal of Food and Nutrition Research ., 2(6): 294-300.
5. International Commission on Microbiological Specifications for Foods.(1996).
Microorganisms in foods 5. Characteristics of microbial pathogens. ICMSF,
International Union of Biological Societies. Blackie Academic & Professional,
London, England.
6. Kruis, W. (2004). Review article: antibiotics and probiotics in inflammatory bowel
disease. Aliment. Pharmacol. Ther, 20 ( 4): 75-78.
7. Faiella-Tommasino, J. and Reigert, H. (2002). E. coli O157:H7–An Emerging
bacterial threat. Clin. Rev., 12: 47-53.
8. Scheutz, F. and Strockbine, NA. (2005). Genus I. Escherichia. In: Brenner, DJ.
(Eds.) The Protebacteria Part B The Gamma proteobacteria. Springer Bergey's Manual
of Systematic Bacteriology., 2 Part B:607-623.
9. Kaper, J. B.; Nataro, J. P. and Mobley, H. L. T. (2004). Pathogenic Escherichia
coli. Natu. Rev. Microbiol., 2: 123-140.
10. LeJeune, JT. ; Besser, TE. ; Rice, DH. and Itancock, DD. (2001). Methods for the
isolation of waterborne Escherichia coli O157:H7. Lett. Appl. Microbiol. , 32, 316–
320.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
144
11. Vincent, NC. ; Veronica, JU. ; Stella, IS. ; Etinosa , OI. and Anthony, IO. ( 2010).
Multidrug resistance and plasmid patterns of Escherichia coli O157 and other E. coli
isolated from diarrhoeal stools and surface waters from some selected sources in Zaria,
Nigeria. Int. J. Environ. Res. Pub. Health., 7:3831-3841 .
12. Imen, B.; Ridha, M. and Mahjoub, A. (2012). Laboratory typing methods for
diagnostic of Salmonella strains, the “old” organism that continued challenges,
Salmonella a dangerous foodborne pathogen.Infect Immun., 57: 3159- 3164.
13. Hayes, P. R. (1985). Food Microbiology and Hygiene. Elsevier, London., pp: 80 - 139.
14. Croci, L.; Delibato, E.; Volpe, G.; De Medici, D. and Palleschi, G. (2004).
Comparison of PCR, Electrochemical Enzyme - Linked Immuno Sorbant Assays and
the standard culture method for detection Salmonella in meat products . Appl. Environ.
Microbiol., 70(3): 1393-1396.
15. Mahon, A.R.; Barnes, M.A.; Senapati, S.; Feder, J.L.; Darling ,J.A. and et al.
(2011). Molecular Detection of Invasive Species in Heterogeneous Mixtures Using a
Microfluidic Carbon Nanotube Platform. PLoS ONE.,6(2):e17280–1-5.
16. Mahon, CR. ; Lehman, DC. and Manuselis, G. (2007). Textbook of diagnostic .3rd
Ed., St. Louis: Saunders., Pp: 215-216.
17. Cagney, C.; Crowley, H.; Duffy, G.; Sheridan, J.J.; O’Brien, S.; Carney, E.;
Anderson, W.; McDowell, D.A.; Blair, I.S. and Bishop, R.H.(2004). Prevalence
and numbers of Escherichia coli O157: H7 in minced beef and beef burgers from
butcher shops and super-markets in the Republic of Ireland. Food Microbiol., 21:203-
212.
18. Modarressi, S. and Thong, K. (2010). Isolation and molecular sub typing of
Salmonella enterica from chicken, beef and street foods in Malaysia. Scientific
Research and Essays., 5(18): 2713-2720.
19. Abuelhassan, N.N.; Abdul Mutalib, S.; Muin, N.M.; Tibin, E.M.M.; Doni, F. And
Yusoff, W.M.W. (2014). Antibiotic Resistance Pattern Among Escherichia Coli
O157:H7 Isolated From Retail Imported Frozen Meat. Asian Jr. of Microbiol. Biotech.
Env. Sc., 16 (3) : 739-744.
20. Stanford, K.; Agopsowicz, C.A. and McAllister, T.A. (2012). Genetic diversity and
antimicrobial resistance among isolates of Escherichia coli O157: H7 from feces and
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
145
hides of super-shedders and low-shedding pen-mates in two commercial beef feedlots.
BMC. Vet. Res.,8:178.
21. Nguyen, T. L.; Truong, H. T. and Nguyen, V. G. (2009). Determining virulence
factors of Escherichia coli strains isolated from diarrhea piglets by using PCR method.
J. Sci. Dev. ,7(2): 187 - 191.
22. Chen, J. and Griffiths, M.W. (1998). PCR differentiation of Escherichia coli from
other Gramnegative bacteria using primers derived from the nucleotide sequences
flanking the gene encoding the universal stress protein. Letters in Applied
Microbiology, 27: 369-371.
23. Macedo, N.R.; Menezes, C.P.L.; Lage, A.P.; Ristow, L.E.; Reis, A. and Guedes,
R.M.C. (2007). Detecção de cepas patogênicas pela PCR multiplex e avaliação da
sensibilidade. Arq. Bras. Med. Vet. Zootec. Belo Horizonte., 59 (5).
24. Osek, J. (2001). Multiplex polymerase chain reaction assay for identification of
enterotoxigenic Escherichia coli strains. J. Vet. Diagn. Investig., 13:308-311.
25. Fasina,F.O.; Bwala, D.G and Madoroba, E.(2015). Investigation of multidrugresistant
fatal colisepticaemia in weanling pigs. Onderstepoort j. vet. res.,82(1):6.