Document Type : Research Paper
Authors
1 Animal Science and Food Science, Ramin Agriculture and Natural Resources University of Khuzestan, Iran
2 Razi Reference Laboratory of Scorpion Research (RRLS), Razi Vaccine and Serum Research Institute, Ahvaz, Khuzestan, Iran
3 National Center for Molecular Genetics and Breeding of Animal, Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing 100193, People’s Republic of China
Abstract
The aim of our study was to investigate effect of FST over-expression by using AAV
serotype 2 (AAV 2) vector on ovine primary myoblast (OPM)differentiation and
proliferation. Primary myoblast cultures were obtained from 60-day-old sheep fetuses.
Western blot confirmed that AAV2 could successfully express FST protein in
transduced primary myoblast cells. Southern blot results demonstrated that AAV
vectors integrated at apparently random genomic sites and promoted the transgenic
myoblast proliferation and differentiation. The results suggested that the AAV system
could be used to generate transgenic meat sheep in the future
Keywords
Article Title [العربیة]
--
Abstract [العربیة]
--
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
258
AAV-2 VECTOR INTEGRATE INTO THE OVINE MYOBLAST
GENOME RANDOMLY AND PROMOTE DIFFERENTIATION
AND PROLIFERATION VIA FOLLISTATIN OVER-EXPRESSION
OF ERK1/2 AND AKT SIGNALING PATHWAYS
Mahmood Nazari*, Fatemeh Salabi**, Lixin Du***
Keywords: Follistatin, over-expression, AAV virus.
*Animal Science and Food Science, Ramin Agriculture and Natural Resources
University of Khuzestan, Iran
**Razi Reference Laboratory of Scorpion Research (RRLS), Razi Vaccine and Serum
Research Institute, Ahvaz, Khuzestan, Iran
***National Center for Molecular Genetics and Breeding of Animal, Institute of
Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing 100193, People’s
Republic of China
ABSTRACT
The aim of our study was to investigate effect of FST over-expression by using AAV
serotype 2 (AAV 2) vector on ovine primary myoblast (OPM)differentiation and
proliferation. Primary myoblast cultures were obtained from 60-day-old sheep fetuses.
Western blot confirmed that AAV2 could successfully express FST protein in
transduced primary myoblast cells. Southern blot results demonstrated that AAV
vectors integrated at apparently random genomic sites and promoted the transgenic
myoblast proliferation and differentiation. The results suggested that the AAV system
could be used to generate transgenic meat sheep in the future.
INTRODUCTION
These features give the AAV System a superior biosafety rating among gene delivery and
expression vectors of viral origin.AAV vectors transduce a variety of somatic tissues,
including skeletal muscle, without eliciting an immune response in mice (1). Recent reports
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
259
have indicated that AAV vectors are capable of integrating the follistatin gene into the host
chromosome and facilitating long-term transduction (2, 3). Follistatin (FST) has been
demonstrated to be a potent antagonist of other members of the TGF-β family, including
myostatin (4). Indeed, over-expression of follistatin by transgenic approaches in muscle has
been shown to increase muscle growth in vivo, and a lack of follistatin results in reduced
muscle mass at birth (5). Several studies have also shown that FST is capable of controlling
muscle mass through pathways independent of the myostatin signaling cascade (6). Myostatin
(MSTN) negatively regulates myoblast proliferation through the activation of Smad, Akt,
p38MAPK and p21 pathways (7-10). Antagonists of MSTN have shown considerable
promise for enhancing muscle mass and strength. MSTN inhibits proliferation and
differentiation of myoblasts, limiting the growth rate and muscle mass in mammals (6).
Recent studies have highlighted the potential benefit of inhibiting MSTN, which results in a
double muscle phenotype in MSTN-deficient cattle (11) and MSTN-knockout mice (12).In
particular, because sheep are an economically important animal, breeding double muscle
sheep is of high economic value. However, AAV-mediated FST gene transfer has not been
reported in sheep, whereas there are several reports of FST gene transfer in sheep by other
vectors, such as lentiviral vectors (13). Using of AAV vectors to produce transgenic animal
can increase biosafety rating for human. The objective of the current study was to use a
recombinant AAV serotype 2 (rAAV2) carrying follistatin to explore the effects of FST on
ovine primary myoblast (OPM) differentiation and proliferation in vitro. In the present study,
we tested the hypothesis that an AAV-2virus carrying the FST gene is capable of inducing
ovine myoblast differentiation and proliferation in vitro.Our results demonstrated that AAV-2
vector can integrate at apparently random genomic sites and promote the myoblast
proliferation and differentiation.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
260
MATERIALS AND METHODS
Plasmid Construction
A complete open reading frame (ORF) of 1035 base pairs of the ovine FST gene was
amplified via PCR from full-length cDNA using the forward primer 5’-
AAGAATTCCCTCAGGATGGCCCGTCCTA-3’ (P1) containing an EcoRI site (underlined)
and the reverse primer 5’-GCTCGAGGGTTTTCCACTCTAGAATGGA -3’ (P2) containing
an XhoI site (underlined). The primers were designed based on the availability of ovine
sequences (Gene Bank Accession No. KF833357). The PCR products and the pAAV-IRESGFP
vector (Agilent Technologies Company, La Jolla, CA) were digested with EcoRI and
XhoI (Fermentas, Life Sciences, Thermo Fisher), recovered through agarose gel
electrophoresis, and then ligated by T4 DNA ligase (New England Biolabs, Beverly, MA).
New recombinant plasmids, which consisted of a CMV promoter and a FLAG tag, carrying
the ovine FST gene were termed pAAV-CFS-FLAG.
Packaging AAV vectors
AAV particles were produced by co-transfection of the recombinant pAAV-CFS-FLAG
vector (20 μg) with two helper plasmids (20 μg each of pAAV-RC and pHelper) into HEK
293 cells. For purification of AAV particles, a ViraBind™ Adeno-Associated Virus
Purification Mega Kit (Cell Biolabs, INC, San Diego, CA, USA) was used according to
manufacturer’s protocol.
Ovine primary myoblast culture and differentiation
Primary myoblast cultures were obtained from 60-day-old sheep fetuses, as previously
described (14).
Western blot analysis
Total protein was extracted quantified using a Nuclear Extraction Kit from the normal
myoblast cells and the transduced myoblast cells to determine MSTN and FST protein
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
261
expression and Total protein was obtained from hind limb fetal skeletal muscle as a control.
A total of 20 μg protein was separated via SDS-PAGE (12%) and transferred to a
nitrocellulose membrane via electro-blotting. The gels run under non-reducing conditions.
SDS-PAGE and western blot transfer were performed using standard techniques. Horseradish
peroxidase activity was detected using ECL plus Western blotting detection reagents
(RPN2132, Amersham Biosciences) and quantified by densitometry by the GelQuantNET
software, and normalized to GAPDH.
Southern blot analysis
Genomic DNA from transgenic and non-transgenic myoblast was purified and aliquots of
DNA (5 μg) were digested by two restriction enzymes EcoRI and HindIII. To remove singlestranded
rAAV genomes and concatamers, DNA was treated with ATP-dependent
exonuclease (4 U per μg; Plasmid Safe; Epicenter) at 37°C overnight after enzyme digestion.
Then, the DNA was resolved on 0.8% agarose gel and then transferred onto a positivecharged
nylon membrane with a vacuum-transfer system. The probe was prepared by PCR
amplification using the forward primer 5’- CTGCCCGCCATGGAGATCGAGT -3’ and
reverse primer 5’- GGCATCTGCATCCGGGGTCTTG -3’ designed based on the GFP
sequence. Hybridization and detection were performed by using a digoxigenin (DIG) high
prime DNA labeling and detection starter kit II (Roche Molecular Biochemicals,
Indianapolis, IN, USA) according to the manufacturer’s instructions.
Cell staining and determination of fusion percentage
Cultures were stained and examined microscopically to determine the percentage of nuclei in
myotubes, as previously described (15). Fusion percentage was assessed by determining the
ratio of the number of myotube nuclei to total nuclei.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
262
Cell proliferation assay
After the incubation period, the cell proliferation assay was performed by adding 20 μl of the
Cell-Counting Kit-8 (CCK-8) reagents (Dojindo Molecular Technologies, Maryland, USA) to
each well of the plate for 2 h. Finally, the absorbance at 450 nm was measured using a
Spectra Max M5 microplate reader (Molecular Devices, CA, USA).
Producing positive transgenic myoblast cells
GFP-positive cell sorting from live population cells was performed on a FACS (MoFlo®
Astrios™) system. The sorted positive cells were stable transfected cells.
Statistics— The data are expressed as the mean ± SEM. The experiments for RT-qPCR were
repeated in replicates of eight but samples were repeated in triplicate for cell cycle and
western blot analysis. One way ANOVA was performed to identify significant changes
between different groups. Student’s t- test was performed to identify significant changes
using SPSS software (version 13.0). Differences are reported at two significance levels, 0.05
or 0.01.
RESULTS
Myoblast proliferation is increased by follistatin over-expression
As shown in Fig. 1, the optical density (at 450 nm) was significantly increased in the
transduced OPMs cultured in GM media after 48, 72 and 96h compared with the control,
indicating that FST significantly increased proliferation (P<0.01). However, the FST protein
induced the growth of myoblasts in a time-dependent manner with half-maximal induction
occurring at the 72h time point (Fig. 1).These data indicated that when OPM cells were
incubated in GM with the AAV-CFs-FLAG virus for 96 h, there was a steady increase in cell
number compared to the control (Fig. 1). The results strongly suggested that AAV-CFs-
FLAG-expressing FST induced a significant effect on cell myoblast proliferation, suggesting
that it is involved in modulating myoblast proliferation.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
263
Follistatin over-expression promotes ovine myoblasts differentiation
Table I shows the fusion percentage average in myotubes in ovine transduced myoblast. The
average percentage of nuclei observed in myotubes transduced with AAV-CFS-FLAG was
47.11%, which was significantly greater than the 32.05% observed with non-transduced cells
(Figs 2; P<0.01, n=10). These findings suggest that the addition of ovine follistatin to
differentiation medium resulted in more nuclei contributing to myotube formation than nontransfected
myoblasts. These results clearly suggested that AAV-CFS-FLAG expressing
follistatin increased the differentiation of primary myoblasts.
FST overexpression induces phosphorelateion of extracellular signal-regulated kinase
(ERK) 1/2 and AKT
Western blot analysis was performed to determine effect of follistatin over-expression on the
phosphorylation of MAPKs such as ERK1/2 and Akt in proliferation condition. Total protein
was isolated after 96 h from the OPM transduced with AAV-CFS-FLAG and the nontransduced
OPMs (control). As shown in Fig. 3, follistatin overexpression induced
phosphorelateion of extracellular signal-regulated kinase (ERK) 1/2 and AKT. The amount of
ERK 1 and ERK 2 phosphorylation after induction time of 96h were increased 1.7 and 2.3-
fold, respectively.
AAV vector integrates into the myoblast genome
The GFP probe was hybridized with genomic DNAs from ovine transgenic and nontransgenic
cells (Fig. 4). The southern blot confirmed stable integration of the transduced
AAV-CFS-FLAG into the ovine genome for transgenic myoblast cells. Moreover, these
results indicate that in transgenic cells the transposition occurred as multiple copy integration
in the different genomic site. As shown in Fig. 4, southern blot results indicated two and three
bands for TC1 and TC3 and also four and five bands for TC4 and TC2, respectively.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
264
DISCUSSION
FST over-expression promotes proliferation through activation of ERK1/2 and Akt
pathways—We performed densitometric analysis of the data obtained from multiple
experiments (n=3) in proliferation condition (Fig. 3). Follistatin over-expresion by AAV2
induced the pERK1 and pERK2 levels 1.7 and 2.3-fold (P<0.01), respectively. As expected,
ERKs (mainly p42 MAPK) were robustly activated in transduced cells (Fig. 3, top, lane 1).
These results suggest that Follistatin over-expresion induced cell proliferation via the
activation of the ERK pathway.
In exploring the signaling mechanism, we focused on Akt, as it is a well-acknowledged
critical signaling node within the cells under both physiological and pathological conditions
and it plays a pivotal role in cell survival. It is known that activation of Akt is critical for cell
survival (19). Here we assessed Akt activation by immunoblotting with an anti-activated Akt
antibody (pAkt) in ovine myoblast cells under proliferation conditions as described in Fig. 5.
Akt was robustly activated in the transduced cells (Fig. 3). Our findings indicated that
follistatin regulated the ERK1/2 (18) and Akt/PKB signaling pathways (20). Our result
showed that follistatin over-expression induced the phosphorylation of ERK1/2 and Akt,
resulting in a significant promotion of ovine myoblast cell proliferation.
CONCLUSIONS
Our results provide the first evidence that the AAV viral system can use to gene transfer in
sheep. Our findings suggest that AAV vectors integrate at apparently random genomic sites
and promote the transgenic myoblast proliferation and differentiation.
These results expanded our understanding of the regulation mechanism of FST in ovine
primary myoblasts. Our findings demonstrated that FST promotes proliferation through
activation of ERK1/2 and AKT pathways in OPMs under proliferating conditions.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
265
REFERENCES
1- Russell, DW.; Deyle, DR:Adeno- associated virus vector integration. Current Opinion in
Molecular Therapy 2010, 11 (4): 442–447.
2- Haidet, AM.; Rizo, L.; Handy, C.; Umapathi, P.; Eagle, A.; Shilling, C.; Boue, D.; Martin,
PT.; Sahen, Z.; Mendell, JR.; Kaspar, BK: Long-term enhancement of skeletal muscle mass
and strength by single gene administration of Myostatin inhibitors. Proc Natl. Acad. Sci. USA
2008,105: 4318–4322.
3- Kota, J.; Handy, CR.; Haidet, AM.; Montgomery, CL.; Eagle, A.; Mendell, JR.; Kaspar,
BK: Follistatin Gene Delivery Enhances Muscle Growth and Strength in Nonhuman
Primates. Sci Transl Med 2010,1(6): 1-17.
4- Amthor, H.; Nicholas, G.; McKinnell, I.; Kemp, CF.; Sharma, M.; Kambadur, R.; Patel, K:
Follistatin complexes myostatin and antagonizes myostatin-mediated inhibition of
myogenesis. Devel Biol 2004. 270, 19–30.
5- Lee, SJ.; McPherron, AC: Regulation of Myostatin activity and muscle growth. Proc Natl
Acad Sci USA 2001,98: 9306–9311.
6- Lee, SJ: Sprinting without Myostatin: a genetic determinant of athletic prowess. Trends
Genet 2007,23: 475-477.
7- Han, DS.; Huang, HP.; Wang, TG.; Hung, MY: Transcription activation of myostatin by
trichostatin A in differentiated C2C12 myocytes via ASK1-MKK3/4/6-JNK and p38
mitogen-activated protein kinase pathways. J Cell Biochemistry 2010, 111: 564-573.
8- Langley, B.; Thomas, M.; Bishop, A.; Sharma, M.; Gilmour S, Kambadur, R: Myostatin
Inhibits Myoblast Differentiation by Down-regulating Myo D Expression. J. Biological.
Chem 2002,277: 49831–49840.
9- Philip, B.; Lu, Z.; Gao, Y: Regulation of GDF-8 signaling by the p38 MAPK. Cell Signal
205,17: 365-375.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
266
10- Trendelenburg, AU.; Meyer, A.; Rohner, D.; Boyle, J.; Hatakeyama, S.; Glass, DJ:
Myostatin reduces Akt/TORC1/p70S6K signaling, inhibiting myoblast differentiation and
myotube size. American J Cell Physiol 2009, 296: C1258-70.
11- Grobet, L.;Martin, LJ.;Poncelet, D.;Pirottin D: A deletion in the bovine myostatin gene
causes the double muscled phenotype in cattle. Nature Genetic 1997, 17: 71–74.
12- Wagner, KR.; McPherron, AC.; Winik, N.; Lee, SJ: Loss of myostatin attenuates severity
of muscular dystrophy in mdx mice. Ann Neurol 2002, 52: 832–836.
13- Zhang, N.; Zhang, X.; Liu, M.; Tan, L: Ovine Follistatin gene expression and functional
analysis of Follistatin domains. Chin J Biotech 2010, 26: 1050−1056.
14- Hembree, JR.; Hathaway, MR.; Dayton, WR: Isolation and culture of fetal porcine
myogenic cells and the effect of insulin, IGF-1, and sera on protein turnover in porcine
myotube cultures. Journal of Animal Science 1991, 69: 3241-3250.
15- Kirstin, G.; Gareth, EJ.; Ramya, T.; Diana, J: The effect of galectin-1 on the
differentiation of fibroblasts and myoblasts in vitro. Journal of Cell Science 2002,115: 355-
366.
16- Thomas, M.; Langley, B.; Berry, C.; Sharma, M.; Kirk, S.; Bass, J.; Kambadur, R:
Myostatin, a Negative Regulator of Muscle Growth, Functions by Inhibiting Myoblast
Proliferation. J. Biological. Chem 2000,275: 40235–40243.
17- Li, ZB.; Kollias, HD.;Wagner, KR: Myostatin directly regulates skeletal muscle fibrosis.
J Biol Chem 2008,283: 19371-19378.
18- Johnson, GL; Lapadat, R: Mitogen-activated protein kinase pathways mediated by ERK,
JNK, and p38 protein kinases. Science 2002, 298: 1911−1912.
19- Manning, BD.; Cantley, LC: AKT/PKB signaling: navigating downstream. Cell 2007,
129: 1261−74.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
267
20- Song, G.; Ouyang, G.; Bao, S: The activation of Akt/PKB signaling pathway and cell
survival. J. Cell. Mol. Med 2005,9 (1): 59–71.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
268
Fig (1) Induction of ovine primary myoblast proliferation by AAV-CFs-FLAG virus
expressing FST protein in vitro. Absorbance (at 450 nm) was read at 48, 72 and 96 hours
after plating in growth media without or with AAV-CFs-FLAG virus. Date were analyzed by
one-way ANOVA (** P < 0.01, n=8, with non-transduced and negative control).
Fig (2) Induction of ovine primary myoblast differentiation by AAV-CFS-FLAG in vitro.
Fusion percentage was calculated for the cells cultured in differentiation media for 48, 72 or
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
269
96 h. Date were analyzed by one-way ANOVA (** P < 0.01, n=10, with non-transduced and
negative control).
Figure (3) Effects of follistatin over-expression on the phosphorylation of ERK1/2 and Akt
protein. Cell lysates were analyzed by immunoblotting using an antibody that was phosphospecific
or specific for total ERK1/2 (upper panel) or Akt (lower panel), respectively.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
270
A
B
Fig (4)A, Western blot analysis was performed to detect GFP protein expression in four
transgenic myoblast clones. Anti GFP antibodies specifically recognized a 26-kDa band for
GFP protein in the four transgenic myoblast clones. Non-transgenic myoblast cells were used
as a control. B, Southern blot analysis of genomic DNA extracted from four transgenic clones
(1, 2, 3 and 4) and non-transgenic myoblast (control).
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
271
Table I.Fusion percentage average in myotubes in ovine myoblast cultures (mean ± S.E.M)*
Percentage of nuclei in myotubes in ten different experiments (mean ± S.E.M.)*
Conditions 1 2 3 4 5 6 7 8 9 10 Mean
control 25.54±3.71 35.81±1.09 26.21±3.50 32.81±2.76 35.64±3.34 32.37±3.52 27.63±2.82 35.94±3.59 31.73±3.08 36.90±2.39 32.05±2.98
AAVCFS-
Flag
57.41±4.91 50.82±2.78 56.77±4.30 43.61±3.71 52.35±2.33 53.11±4.34 43.21±4.31 43.71±2.20 62.30±2.10 51.60±2.50 47.11±3.34
*The percentages are the mean ± S.E.M. for nine counts in each well.
Molecular Therapy 2010, 11 (4): 442–447.
2- Haidet, AM.; Rizo, L.; Handy, C.; Umapathi, P.; Eagle, A.; Shilling, C.; Boue, D.; Martin,
PT.; Sahen, Z.; Mendell, JR.; Kaspar, BK: Long-term enhancement of skeletal muscle mass
and strength by single gene administration of Myostatin inhibitors. Proc Natl. Acad. Sci. USA
2008,105: 4318–4322.
3- Kota, J.; Handy, CR.; Haidet, AM.; Montgomery, CL.; Eagle, A.; Mendell, JR.; Kaspar,
BK: Follistatin Gene Delivery Enhances Muscle Growth and Strength in Nonhuman
Primates. Sci Transl Med 2010,1(6): 1-17.
4- Amthor, H.; Nicholas, G.; McKinnell, I.; Kemp, CF.; Sharma, M.; Kambadur, R.; Patel, K:
Follistatin complexes myostatin and antagonizes myostatin-mediated inhibition of
myogenesis. Devel Biol 2004. 270, 19–30.
5- Lee, SJ.; McPherron, AC: Regulation of Myostatin activity and muscle growth. Proc Natl
Acad Sci USA 2001,98: 9306–9311.
6- Lee, SJ: Sprinting without Myostatin: a genetic determinant of athletic prowess. Trends
Genet 2007,23: 475-477.
7- Han, DS.; Huang, HP.; Wang, TG.; Hung, MY: Transcription activation of myostatin by
trichostatin A in differentiated C2C12 myocytes via ASK1-MKK3/4/6-JNK and p38
mitogen-activated protein kinase pathways. J Cell Biochemistry 2010, 111: 564-573.
8- Langley, B.; Thomas, M.; Bishop, A.; Sharma, M.; Gilmour S, Kambadur, R: Myostatin
Inhibits Myoblast Differentiation by Down-regulating Myo D Expression. J. Biological.
Chem 2002,277: 49831–49840.
9- Philip, B.; Lu, Z.; Gao, Y: Regulation of GDF-8 signaling by the p38 MAPK. Cell Signal
205,17: 365-375.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
266
10- Trendelenburg, AU.; Meyer, A.; Rohner, D.; Boyle, J.; Hatakeyama, S.; Glass, DJ:
Myostatin reduces Akt/TORC1/p70S6K signaling, inhibiting myoblast differentiation and
myotube size. American J Cell Physiol 2009, 296: C1258-70.
11- Grobet, L.;Martin, LJ.;Poncelet, D.;Pirottin D: A deletion in the bovine myostatin gene
causes the double muscled phenotype in cattle. Nature Genetic 1997, 17: 71–74.
12- Wagner, KR.; McPherron, AC.; Winik, N.; Lee, SJ: Loss of myostatin attenuates severity
of muscular dystrophy in mdx mice. Ann Neurol 2002, 52: 832–836.
13- Zhang, N.; Zhang, X.; Liu, M.; Tan, L: Ovine Follistatin gene expression and functional
analysis of Follistatin domains. Chin J Biotech 2010, 26: 1050−1056.
14- Hembree, JR.; Hathaway, MR.; Dayton, WR: Isolation and culture of fetal porcine
myogenic cells and the effect of insulin, IGF-1, and sera on protein turnover in porcine
myotube cultures. Journal of Animal Science 1991, 69: 3241-3250.
15- Kirstin, G.; Gareth, EJ.; Ramya, T.; Diana, J: The effect of galectin-1 on the
differentiation of fibroblasts and myoblasts in vitro. Journal of Cell Science 2002,115: 355-
366.
16- Thomas, M.; Langley, B.; Berry, C.; Sharma, M.; Kirk, S.; Bass, J.; Kambadur, R:
Myostatin, a Negative Regulator of Muscle Growth, Functions by Inhibiting Myoblast
Proliferation. J. Biological. Chem 2000,275: 40235–40243.
17- Li, ZB.; Kollias, HD.;Wagner, KR: Myostatin directly regulates skeletal muscle fibrosis.
J Biol Chem 2008,283: 19371-19378.
18- Johnson, GL; Lapadat, R: Mitogen-activated protein kinase pathways mediated by ERK,
JNK, and p38 protein kinases. Science 2002, 298: 1911−1912.
19- Manning, BD.; Cantley, LC: AKT/PKB signaling: navigating downstream. Cell 2007,
129: 1261−74.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
267
20- Song, G.; Ouyang, G.; Bao, S: The activation of Akt/PKB signaling pathway and cell
survival. J. Cell. Mol. Med 2005,9 (1): 59–71.