Document Type : Research Paper
Author
Department of Clinical Science, Veterinary Faculty, Shahid Chamran University, Ahvaz, Iran
Abstract
Genetic markers are one of the best methods to evaluate animal genetics potential.
FecX, FecB and FecG genes have belonged to TGFβ superfamily. These genes have
additive effect on litter size and ovulation rate in sheep. The aim of the present study was
determination of FecX, FecB and FecGH mutations in Iranian Arabic sheep. In this study
100 blood samples were collected of prolific sheep of Arabic breeds. DNA of blood
samples was extracted by modified salting out method. Site of mutation was amplified
using specific primers and PCR products were digested with special restricted enzymes
for FecX, FecB and FecGH mutations. Results have showed no mutations of FecX, FecB
and FecGH mutation were detected in Iranian Arabic sheep breed. Therefore, FecX, FecB
and FecGH mutations did not cause of prolificacy in this breed and further research is
required to evaluate the relationship of the fecundity genes with litter size and ovulation
rate in this breed.
Keywords
Article Title [العربیة]
--
Abstract [العربیة]
--
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
435
DETERMINATION OF FECX, FECB AND FECGH MUTATIONS IN
IRANIAN ARABIC SHEEP
Godratollah Mohammadi
Department of Clinical Science, Veterinary Faculty, Shahid Chamran University, Ahvaz,
Iran
Key word: Iranian Arabic sheep, FecX, fecundity gene
ABSTRACT
Genetic markers are one of the best methods to evaluate animal genetics potential.
FecX, FecB and FecG genes have belonged to TGFβ superfamily. These genes have
additive effect on litter size and ovulation rate in sheep. The aim of the present study was
determination of FecX, FecB and FecGH mutations in Iranian Arabic sheep. In this study
100 blood samples were collected of prolific sheep of Arabic breeds. DNA of blood
samples was extracted by modified salting out method. Site of mutation was amplified
using specific primers and PCR products were digested with special restricted enzymes
for FecX, FecB and FecGH mutations. Results have showed no mutations of FecX, FecB
and FecGH mutation were detected in Iranian Arabic sheep breed. Therefore, FecX, FecB
and FecGH mutations did not cause of prolificacy in this breed and further research is
required to evaluate the relationship of the fecundity genes with litter size and ovulation
rate in this breed.
INTRODUCTION
In recent years, many studies focused on the genetics of prolificacy in sheep (Ovis aries).
three major genes: BMP15, BMPR1B and FecG, which have been shown to have
enhancing effects on ovulation rate and litter size (1). All these three Fecundity genes
belong to the transforming growth factor β (TGFβ) gene superfamily (2).
Bone morphogenetic protein 15 (BMP-15) is a growth factor that is specifically
expressed in oocytes. The sheep BMP-15 (FecX) gene maps to the X chromosome (3).
FecX regulates granulosa cell proliferation and differentiation by promoting granulose
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
436
cell mitosis, suppressing follicle-stimulating hormone receptor expression, and
stimulating kit ligand expression, all of these affects play a pivotal role in female fertility
(4). The FecX gene have FecXI, FecXH, FecXB and FecXG mutants (3, 5, 6). The
homozygote for the four mutations in ewes is infertile whereas the heterozygous
individuals have a greater ovulation rate size (7, 6).
The sheep GDF9 (Growth Differentiation Factor 9) gene maps to chromosome 5 and
contains 2 exons (8). Eight single nucleotide polymorphisms (SNPs) have been identified
so far in sheep GDF9, labeled G1–G8. The G8 mutation, also indicated as FecGH (High
Fertility), causes increased ovulation rate in heterozygous ewes, while homozygous ewes
are sterile (6, 9).
The fecB gene which called bone morphogenetic protein receptor 1B (BMPR1B) Located
on ovine chromosome 6 corresponding to the human chromosome 4q22-23 (10). The A
to G transition at nucleotide position 746 of the cDNA sequence induces a
nonsynonymous substitution of glutamine with an arginine corresponding to position 249
of the mature protein (11, 12). Based on the segregation of the ovulation rate in Merino
and Romney flocks, the genotypes in the ewes have been classified as homozygous
noncarrier (FecB+/FecB+) with ovulation rate of 2 or less, heterozygous carriers
(FecBB/FecB+) with ovulation rate of 3–4 and homozygous carriers (FecBB/FecBB)
with more than five ovulations per estrous cycle (13). This increased ovulation rate of
FecBB carriers is associated with a precocious maturation of a large number of antral
follicles that ovulate at a smaller size than non-carrier follicles (14).
Arabic sheep are one the most prolific sheep breed in the Khuzestan province in south
western of Iran. This sheep breed are the most important sources of meat in the area.
average live weight of adult ranges between 45 to 55 kg. the mean litter size for this
breed is 1.5. Characterization of fecundity genes in this breed can help improvement
breeding program Therefore, the aim of the present study was identification of FecX,
FecB and FecGH mutations in this sheep breed.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
437
MATERIAL AND METHODS
Samples and breeds
The analysis was carried out on a samples of 100 prolific sheep of Arabic breeds. Blood
samples were collected into a 5 ml EDTA contained vacutainer tube and transferred to
laboratory for DNA extraction within 2 hours. Total DNA extractions were made with a
modified salting out method and isopropanol precipitation (15) from whole fresh blood.
DNA samples were quantified using Biophotometer (Eppendorf) and stored in −20°C in
aliquots.
The amplification of the loci was carried out in a total volume of 25 μl reaction (16). The
reaction contained the following constituents: 100 ng of DNA used as a template, 1X
PCR Buffer, 0.2 mM of each dNTP, 0.5 μM of each primer, 1 unit of Taq Polymerase
and 1.5 mM of MgCl2. PCR amplifications were performed in a Gradient Thermocycler
(Bioer Xp cycler) by an initial denaturation of 5 min at 95°C, followed by 35 cycles of 30
seconds of denaturation at 94°C, 30 seconds of annealing based on table 1, 30 seconds of
extension at 72°C and a final extension of 10 min at 72°C. The amplified products were
electrophoresed in 2% agarose gele and the DNA bands were visualized by ethidium
bromide staining technique.
All primers were synthesized by TAG Copenhagen Co., Ltd (Denmark). The restriction
endonucleases (RE) and other reagents were purchased from Fermentas Co, Ltd. The
primers sequence, annealing temperature and RE are described in Table 1.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
438
Table 1, Primer sequences, Annealing temperature and Restriction enzyme used for
PCR-RFLP
Annealing Primer Sequence (5́→3)́ Gene
Temperature
( ̊ C)
Restriction
enzyme
TATTTCAATGACACTCAGAG FecXH
GAGCAATGATCCAGTGATCCCA
SpeI 55
GAAGTAACCAGTGTTCCCTCCACCCTTTTCT FecXI
CATGATTGGGAGAATTGAGACC
XbaI 55
CACTGTCTTCTTGTTACTGTATTTCAATGAGAC FecXG
GATGCAATACTGCCTGCTTG
HinfI 63
GCCTTCCTGTGTCCCTTATAAGTATGTTCCCCTTA FecXB
TTCTTGGGAAACCTGAGCTAGC
DdeI 64
CCAGAGGACAATAGCAAAGCAAA FecB
CAAGATGTTTTCATGCCTCATCAACAGGTC
AvaII 60
CTTTAGTCAGCTGAAGTGGGACAAC FecGH
ATGGATGATGTTCTGCACCATGGTGTGAACCTGA
DdeI 62
According to (6), (17) and (3), forced PCR-RFLP was used to detect the mutations of
FecX (FecXB, FecXG, FecXH, FecXI), FecB and FecGH. The mutations, restriction
enzymes, restriction sites, wild type and mutant fragments size are shown in Table 2.
Mutation Restriction
enzyme
Restriction
site
wild-type fragment
size bp
Mutant fragment
size bp
Refference
FecXB DdeI C/TTAG Cleaved (122 and
31)
Uncleaved 153 Hanrahan
et al. 2004
FecXG HinfI G/ACT Cleaved (112 and
29)
Uncleaved 141 Hanrahan
et al. 2004
FecXH SpeI A/CTAGT Uncleaved 240 Cleaved (218 and
22)
Galloway
et al., 2000
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
439
Table 2, The mutations, restriction enzymes, restriction sites, wild type and mutant
fragments size
RESULTS
The electrophoresis Results of forced PCR-RFLP are showed in Figs. 1, 2, 3, 4, 5 and 6,
respectively. The mutations of FecX, FecB and FecGH gene were tested in samples from
the arabic sheep breeds. All of the 100 individuals were wild homozygote for FecX, FecB
and FecGH. None of the samples carried the mutation in FecX, FecB and FecGH genes.
Fig. 1. Image of PCR product of the FecXB mutation of the BMP-15 gene (153 bp)
digested with DdeI. M= 50 bp DNA marker. The wild-type allele is 122 bp.
Fig. 2. Image of PCR product of the FecXG mutation of the BMP-15 gene (141 bp)
digested with HinfI. M= 50 bp DNA marker. The wild-type allele is 112 bp but the
mutation type remains uncleaved.
FecXI XbaI T/CTAGA Uncleaved 154 Cleaved (124 and
30)
Galloway
et al. 2000
FecB AvaII G/GACC Uncleaved 190 Cleaved (160 and
30)
Davis et al.
2002
FecGH DdeI C/TTAG Cleaved Uncleaved Hanrahan
et al. 2004
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
440
Fig. 3. Image of PCR product of the FecXH mutation of the BMP-15 gene (240 bp)
digested with SpeI. M= 50 bp DNA marker. The wild-type allele is 240 bp.
Fig. 4. Image of PCR product of the FecXI mutation of the BMP-15 gene (154 bp)
digested by XbaI. M= 50 bp DNA marker. The wild-type allele is 154 bp but the
mutation type remained cleaved by XbaI.
Fig .5 .Agarose gele electrophoretogram for GDF 9mutation loci product digested by
DdeI showing genotypes. M: 50 bp DNA Marker. Lanes 1-8 represent different digestion
products of samples from Arabic sheep.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
441
Fig .6 .Agarose gel electrophoresis(2%) of allele specific BMPRIB PCR products
digested by AvaII showing genotypes. M: 50 bp DNA Marker ،Lanes 1-6 represent
different digestion products of samples from Arabic sheep breed.
DISCUSSIONS
Sheep is a small and litter-bearing animal, and ideally suited as a model organism for
studying on fecundity genes. The FecX, FecB and FecG genes have been found to be
closely associated with prolificacy in sheep (18, 6, 3, 19).
BMP15 is located in the X chromosome. Four mutations in this gene affecting prolificacy
have been described. They originate either nonconservative aminoacidic substitutions
(FecXB and FecXI) or premature stop codons (FecXG and FecXH) having a dosagedependent
effect, While ovulation rates are highly increased in the heterozygotes, the
homozygotes show a primary ovarian failure resulting in complete sterility (3, 6, 20).
It has been reported that the litter size and ovulation rate in sheep increase with number
of mutations in FecB gene. Ewes inheriting one copy of the Booroola gene from either of
parents produced about 1.5 extra eggs and gave birth to about 1.0 extra lamb per lambing.
Homozygous carriers produced about 3.0 extra eggs resulting in about 1.5 extra lambs
per lambing (2). This increase in ovulation rate of FecBB carriers is associated with a
precocious maturation of a large number of antral follicles that ovulate at a smaller size
than non-carrier follicles (14).
The FecGH (G8) mutation in GDF9 gene causes an amino acid substitution that has been
reported to be associated with increased prolificacy in Belclare and Cambridge sheep (6).
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
442
Ovulation rates in GDF9 and BMP15 mutants are high in the heterozygotes. The
homozygotes, however, have small, flattened streak ovaries with follicles that do not
develop up to the primary stage (6, 9, 20) resulting in complete sterility in these animals
(6, 20, 19).
The FecB mutations have been reported in some of the world's most prolific sheep breeds
viz. Australian Booroola Merino (11), Indian Garole, Indonesian Javanese (17), Smalltailed
Han and Hu sheep of China (5).
In the present study, we utilized FecX (FecXB, FecXG, FecXH, FecXI), FecB and FecGH as
candidates, but did not find any polymorphism of genes in Arabic sheep.
The studies showed that maybe FecX, FecB and FecGH were not the only reason
responsible for the high prolificacy of sheep (5, 21).
Several investigations show that the FecBB allele is absent in low prolific sheep breeds
(7, 22), but it is also absent in many prolific sheep, such as Olkuska, Thoka and
Woodlands breeds (1). The absence of the currently known prolificacy genotypes in these
Iranian sheep breeds implies the possibility that these important mutations affecting
prolificacy may be introduced in these breeds by genetic introgression. Indeed genetic
introgression can be very beneficial because it allows the introduction of a genotype
selectively advantageous in a breed already adapted to the environment in which it is
reared (23, 22). Two examples among many, i.e. the FecB mutation has been introgressed
from Garole sheep into Deccani and Bannur sheep, improving the reproductive
performance of local non-prolific breeds (24) and the crossbreeding of Garole×Malpura
allowed the introgression of the FecB genotype carried by Garole sheep into the nonprolific
Malpura, improving the mean litter size of the crossbreds (25).
The incorporation of a major gene for prolificacy into a flock can be achieved using
marker- assisted selection, artificial insemination and embryo transfer programmes (1).
All of this information can be used for the improvement of Iranian sheep breeding to be
applied in those areas of the country where environmental conditions allow taking
advantage from the improvement of prolificacy.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
443
ACKNOWLEDGMENTS
This study was kindly granted by Vice Chancellor in Research of Shahid Chamran
University of Ahvaz, Iran.
REFERENCES
1. Davis, G.H (2005). Major genes affecting ovulation rate in sheep.
Genet. Sel. Evol. 37(S1):S11–S23.
2. Fabre, S: Pierre, A; Mulsant, P. et al. (2006). Regulation of ovulation rate in
mammals: contribution of sheep genetic models. Reprod. Biol. Endo. 4:20-31.
3. Galloway, S.M; McNatty, K.P; Cambridge, L.M, et al. (2000). Mutations in an
oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and
infertility in a dosage-sensitive manner. Nat. Genet. 25 (3):279–283.
4. Juengel, J.L; Hudson, N.L; Heath, D.A, et al. (2002). Growth differentiation
factor 9 and bone morphogenetic protein 15 are essential for ovarian follicular
development in sheep. Biol. Reprod. 67(6):1777–1789.
5. Davis, G.H; Balakrishnan, L; Ross I.K, et al. (2006). Investigation of the
Booroola (FecB) and Inverdale (FecX(I)) mutations in 21 prolific breeds and
strains of sheep sampled in 13 countries. Anim. Reprod. Sci. 92(1–2):87–96.
6. Hanrahan, J.P; Gregan, S.M; Mulsant, P, et al. (2004). Mutations in the genes for
oocyte-derived growth factors GDF9 and BMP15 are associated with both
increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis
aries). Biol. Reprod. 70 (4):900–909.
7. Chu, M.X; Liu, Z,H; Jiao, CL, et al. (2007). Mutations in BMPR 1B and BMP 15
genes are associated with litter size in Small Tailed Han sheep. J. Anim. Sci.
85:598–603.
8. Bodensteiner, K.J; Clay, C.M; Moeller, C.L; Sawyer, H.R (1999). Molecular
cloning of the ovine growth/differentiation factor-9 gene and expression of
growth/differentiation factor-9 in ovine and bovine ovaries. Biol. Reprod.
60(2):381–386.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
444
9. McNatty, K.P; Galloway, S.M; Wilson, T, et al. (2005). Physiological effects of
major genes affecting ovulation rate in sheep. Genet. Selec. Evol. 37(S1):S25–
S38.
10. Montgomery, G.W; Crawford, A.M; Penty, J.M, et al. (1993). The ovine
Booroola fecundity gene (FecB) is linked to markers from a region of human
chromosome 4q. Nat. Genet. 4 (4):410–414.
11. Souza, C.J; MacDougall, C; Campbell, B.K; McNeilly, A.S; Baird, D.T (2001).
The Booroola (FecB) phenotype is associated with a mutation in the bone
morphogenetic receptor type 1 B (BMPR1B) gene. J. Endo. 169(2): R1–R6.
12. Mulsant, P; Lecerf, F; Fabre, S, et al. (2001). Mutation in bone morphogenetic
protein receptor-IB is associated with increased ovulation rate in Booroola Merino
ewes. Proc. Nat. Acad. Sci. 98(9):5104–5109.
13. Davis, G.H; Montgomery, G.W; Allison, A.J; Kelly, R.W; Bray, A.R (1982).
Segregation of a major gene influencing fecundity in progeny of Booroola sheep.
N.Zeal. J. Agri. Res. 25(4):525–529.
14. McNatty, K.P; Lun, S; Heath, D.A, et al. (1986). Differences in ovarian activity
between Booroola Merino ewes which were homozygous, heterozygous and noncarriers
of a major gene influencing their ovulation rate. J. Reprod. Fertil. 77
(1):193-205.
15. Mohammadi, G and Saberivand, A (2009). Simple method to extract DNA from
mammalian whole blood. J. mol. Genet. 1(1):7-10.
16. Crawford, A.M; Dodds, K.G; Ede, AJ, et al. (1995). An autosomal genetic linkage
map of the sheep genome. Genetics. 140(2):703–24.
17. Davis, G.H; Galloway, S.M; Ross I.K, et al. (2002). DNA tests in prolific sheep
from eight countries provide new evidence on origin of the Booroola (FecB)
mutation. Biol. Reprod. 66(6):1869–1874.
18. Souza, C.J; MacDougall, C; MacDougall, C; Campbell, B.K; McNeilly, A.S and
Baird, D.T (2001). The Booroola (FecB) phenotype is associated with a mutation
in the bone morphogenetic receptor type 1 B (BMPR1B) gene. J. Endo.
169(2):R1–R6.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
445
19. Monteagudo, L.V; Ponz, R; Tejedor, M.T; Lavina, A and Sierra, I (2009). A 17
bp deletion in the bone morphogenetic protein 15 (BMP15) gene is associated to
increased prolificacy in the Rasa Aragonesa sheep breed. Anim. Reprod. Sci.
110(1-2):139–146.
20. Bodin, L; Di Pasquale, E; Fabre, S, et al. (2007). A novel mutation in the bone
morphogenetic protein 15 gene causing defective protein secretion is associated
with both increased ovulation rate and sterility in Lacaune sheep. Endocrinology.
148(1):393–400.
21. Guan, F; Liu, S.R; Shi, G.Q and Yang, L.G (2006). Polymorphism of FecB gene
in nine sheep breeds or strains and its effects on litter size, lamb growth and
development. Anim. Reprod. Sci. 33(2):117-24.
22. Hua, G.H and Yang, L.G (2009). A review of research progress of FecB gene in
Chinese breeds of sheep. Anim. Reprod. Sci. 116(1-2):1–9.
23. Gootwine, E; Reicher, S and Rozov, A (2008). Prolificacy and lamb survival at
birth in Awassi and Assaf sheep carrying the FecB (Booroola) mutation. Anim.
Reprod. Scie. 108(3-4):402–411.
24. Pardeshi, V.C; Sainani, M.N; Maddox, J.F; Ghalsasi, P.M; Nimbkar, C and Gupta
V.S (2005). Assessing the role of FecB mutation in productivity of Indian sheep.
Cur. Sci. 89(5):887–890.
25. Kumar, S; Kolte, A.P; Mishra, A.K; Arora, A.L and Singh, V.K (2006).
Identification of the FecB mutation in Garole×Malpura sheep and its effect on
litter size. S. Rumin. Res. 64(3):305–310.
Genet. Sel. Evol. 37(S1):S11–S23.
2. Fabre, S: Pierre, A; Mulsant, P. et al. (2006). Regulation of ovulation rate in
mammals: contribution of sheep genetic models. Reprod. Biol. Endo. 4:20-31.
3. Galloway, S.M; McNatty, K.P; Cambridge, L.M, et al. (2000). Mutations in an
oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and
infertility in a dosage-sensitive manner. Nat. Genet. 25 (3):279–283.
4. Juengel, J.L; Hudson, N.L; Heath, D.A, et al. (2002). Growth differentiation
factor 9 and bone morphogenetic protein 15 are essential for ovarian follicular
development in sheep. Biol. Reprod. 67(6):1777–1789.
5. Davis, G.H; Balakrishnan, L; Ross I.K, et al. (2006). Investigation of the
Booroola (FecB) and Inverdale (FecX(I)) mutations in 21 prolific breeds and
strains of sheep sampled in 13 countries. Anim. Reprod. Sci. 92(1–2):87–96.
6. Hanrahan, J.P; Gregan, S.M; Mulsant, P, et al. (2004). Mutations in the genes for
oocyte-derived growth factors GDF9 and BMP15 are associated with both
increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis
aries). Biol. Reprod. 70 (4):900–909.
7. Chu, M.X; Liu, Z,H; Jiao, CL, et al. (2007). Mutations in BMPR 1B and BMP 15
genes are associated with litter size in Small Tailed Han sheep. J. Anim. Sci.
85:598–603.
8. Bodensteiner, K.J; Clay, C.M; Moeller, C.L; Sawyer, H.R (1999). Molecular
cloning of the ovine growth/differentiation factor-9 gene and expression of
growth/differentiation factor-9 in ovine and bovine ovaries. Biol. Reprod.
60(2):381–386.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
444
9. McNatty, K.P; Galloway, S.M; Wilson, T, et al. (2005). Physiological effects of
major genes affecting ovulation rate in sheep. Genet. Selec. Evol. 37(S1):S25–
S38.
10. Montgomery, G.W; Crawford, A.M; Penty, J.M, et al. (1993). The ovine
Booroola fecundity gene (FecB) is linked to markers from a region of human
chromosome 4q. Nat. Genet. 4 (4):410–414.
11. Souza, C.J; MacDougall, C; Campbell, B.K; McNeilly, A.S; Baird, D.T (2001).
The Booroola (FecB) phenotype is associated with a mutation in the bone
morphogenetic receptor type 1 B (BMPR1B) gene. J. Endo. 169(2): R1–R6.
12. Mulsant, P; Lecerf, F; Fabre, S, et al. (2001). Mutation in bone morphogenetic
protein receptor-IB is associated with increased ovulation rate in Booroola Merino
ewes. Proc. Nat. Acad. Sci. 98(9):5104–5109.
13. Davis, G.H; Montgomery, G.W; Allison, A.J; Kelly, R.W; Bray, A.R (1982).
Segregation of a major gene influencing fecundity in progeny of Booroola sheep.
N.Zeal. J. Agri. Res. 25(4):525–529.
14. McNatty, K.P; Lun, S; Heath, D.A, et al. (1986). Differences in ovarian activity
between Booroola Merino ewes which were homozygous, heterozygous and noncarriers
of a major gene influencing their ovulation rate. J. Reprod. Fertil. 77
(1):193-205.
15. Mohammadi, G and Saberivand, A (2009). Simple method to extract DNA from
mammalian whole blood. J. mol. Genet. 1(1):7-10.
16. Crawford, A.M; Dodds, K.G; Ede, AJ, et al. (1995). An autosomal genetic linkage
map of the sheep genome. Genetics. 140(2):703–24.
17. Davis, G.H; Galloway, S.M; Ross I.K, et al. (2002). DNA tests in prolific sheep
from eight countries provide new evidence on origin of the Booroola (FecB)
mutation. Biol. Reprod. 66(6):1869–1874.
18. Souza, C.J; MacDougall, C; MacDougall, C; Campbell, B.K; McNeilly, A.S and
Baird, D.T (2001). The Booroola (FecB) phenotype is associated with a mutation
in the bone morphogenetic receptor type 1 B (BMPR1B) gene. J. Endo.
169(2):R1–R6.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
445
19. Monteagudo, L.V; Ponz, R; Tejedor, M.T; Lavina, A and Sierra, I (2009). A 17
bp deletion in the bone morphogenetic protein 15 (BMP15) gene is associated to
increased prolificacy in the Rasa Aragonesa sheep breed. Anim. Reprod. Sci.
110(1-2):139–146.
20. Bodin, L; Di Pasquale, E; Fabre, S, et al. (2007). A novel mutation in the bone
morphogenetic protein 15 gene causing defective protein secretion is associated
with both increased ovulation rate and sterility in Lacaune sheep. Endocrinology.
148(1):393–400.
21. Guan, F; Liu, S.R; Shi, G.Q and Yang, L.G (2006). Polymorphism of FecB gene
in nine sheep breeds or strains and its effects on litter size, lamb growth and
development. Anim. Reprod. Sci. 33(2):117-24.
22. Hua, G.H and Yang, L.G (2009). A review of research progress of FecB gene in
Chinese breeds of sheep. Anim. Reprod. Sci. 116(1-2):1–9.
23. Gootwine, E; Reicher, S and Rozov, A (2008). Prolificacy and lamb survival at
birth in Awassi and Assaf sheep carrying the FecB (Booroola) mutation. Anim.
Reprod. Scie. 108(3-4):402–411.
24. Pardeshi, V.C; Sainani, M.N; Maddox, J.F; Ghalsasi, P.M; Nimbkar, C and Gupta
V.S (2005). Assessing the role of FecB mutation in productivity of Indian sheep.
Cur. Sci. 89(5):887–890.
25. Kumar, S; Kolte, A.P; Mishra, A.K; Arora, A.L and Singh, V.K (2006).
Identification of the FecB mutation in Garole×Malpura sheep and its effect on
litter size. S. Rumin. Res. 64(3):305–310.