Document Type : Research Paper
Authors
1 *Department of Microbiology, Collage of Veterinary Medicine, University of Basrah, Basrah,Iraq.
2 Department of Microbiology, Collage of Veterinary Medicine, University of Basrah, Basrah,Iraq.
Abstract
The Phenotypic identification results revealed that Lactic Acid Bacteria (LAB
)isolates which is characterized by both Gram positive and catalase negative reactions
was observed in 51 % of cow raw milk bacterial isolates with 51% an overall ratio.The
higher results(58.5%.) of conventionallbacteriological analysis were observed in raw
milk bacterial isolates of cows lat first age group(≥3 - < 9 year) , There was
significantleffect ( p< 0.05)for the cows age on the raw milk bacterial
isolatesldistribution .The number of parturition affect significantly ( p< 0.05) on thelraw
milk bacterial isolates distribution and high ratio( 52%)of LAB isolateslwas observed in
cows with ≥6-<12 number oflparturition
Depending on genotypic identification results the high ratio (100%) of
positivelresults of 16S rDNA based PCR appeared in all of raw milk bacterial isolates
of cowslat second age group(≥9 - ˂15 year) , and the difference between the two
agelgroups stastically was not considered significant (P>0.05)..The number of
parturitionlhad اhigh significant effect (p< 0.001) on16S rDNA based PCR
positivelresults and high ratio(50%) of these results was observed inlcows with 1 - <
6 number oflparturition.Subsequent bacteriocin encoding geneslbased PCR analysis
of 16S rDNA genes based PCR positive LAB revealed that higher ratio of PCR
positive results (60.9%) was observed in EntlB followed by Nis encoding
genes(30.4%) . High significant difference(P<0.01) was observed amonglthe Nis, Ent
A and Ent B encoding genes based PCR positivelresults.
Keywords
Article Title [العربیة]
التشخیص المظھری و الوراثی لبکتریا حامض اللاکتک المنتجھ للبکتریوسین المعزولھ من حلیب الابقار
Authors [العربیة]
- ھبة الرحمن ریاض 1
- ،فوزیھ علی عبدلله 2
1 فرع الاحیاء المجھریھ،کلیة الطب البیطری،جامعة البصره،البصره،العراق
2 فرع الاحیاء المجھریھ،کلیة الطب البیطری،جامعة البصره،البصره،العراق
Abstract [العربیة]
اظھرت نتائج التشخیص المظھری ان بکتریا حامض اللاکتک الموجبة الکرام وغیر المنتجھ لانزیم الکتلیز
تواجدھا لوحظ فی 51 نموذج من حلیب الابقار الخام وکانت نسبتھا الکلیھ % 51 . ولوحظت اعلى نتائج
58.5% )للاختبارات البکتریلوجیھ التشخیصیھ التقلیدیھ من العزلات البکتریھ المأخوذه من حلیب الابقار التی .)
على توزیع عزلات ( p< 3≤) سنھ، وکان لعمر الابقار تاثیر احصائی معنوی ( 0.05 - < تتراوح اعمارھا بین ( 9
على عزلات بکتریا حلیب ( p< البکتریا للحلیب الخام، کذلک کان لعدد الولادات تأثیر احصائی معنوی( 0.05
الابقار الخام، حیث لوحظت اعلى نسبھ (% 52 )لعزلات بکتریا حامض اللاکتک فی الابقار التی تکون عدد الولادات
≥6-< فیھا 12
16 ا S rDNA المعتمد على PCR اعتمادا على نتائج التشخیص الوراثی کانت اعلى نسبھ(% 100 ) لنتائج
9≤) وان الفرق بین الفئتین - ˂15 year) لموجبھ فی جمیع عزلات الحلیب الخام للابقار من الفئھ العمریھ الثانیھ
على (p< عدد الولادات کان لھ تاثیر عالی المعنویھ ( 0.001 .(P> العمریتین لم یعتبر ذو معنویھ احصائیھ.( 0.05
16 وا ن اعلى نسبھ(% 50 ) لھذه النتائج لوحظت فی الابقار التی لھا عدد S rDNA المعتمده على PCR نتائج
المعتمد على الجینات المشفره للبکتریوسین الذی اجری لاحقا على PCR 1). اظھرت نتائج تحلیل - < ولادات( 6
16 ان اعلى نسبھ(% 60.9 ) لنتائج S rDNA الموجبھ المعتمده على PCR جراثیم حامض اللاکتک ذات نتائج
وتلتھا نسبة (% 30.4 ) الجینات المشفره للنیاسین.لوحظ فرق احصائی EntlB الموجبھ قد لوحظت فی جینات PCR
.Ent B وEnt A الموجبھ المعتمده على الجینات المشفره للنیاسین و PCR عالی المعنویھ بین نتائج
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
446
PHENOTYPIC AND GENOTYPIC IDENTIFICATION OF
BACTERIOCIN PRODUCER LACTIC ACID BACTERIA
ISOLATED FROM COWS MILK
Hibbat Al Rahman, R.* , Fawziah A. Abdullah*
*Department of Microbiology, Collage of Veterinary Medicine, University of Basrah,
Basrah,Iraq.
Keywords; Cowraw milk , bacteriocinogenic LAB
ABSTRACT
The Phenotypic identification results revealed that Lactic Acid Bacteria (LAB
)isolates which is characterized by both Gram positive and catalase negative reactions
was observed in 51 % of cow raw milk bacterial isolates with 51% an overall ratio.The
higher results(58.5%.) of conventionallbacteriological analysis were observed in raw
milk bacterial isolates of cows lat first age group(≥3 - < 9 year) , There was
significantleffect ( p< 0.05)for the cows age on the raw milk bacterial
isolatesldistribution .The number of parturition affect significantly ( p< 0.05) on thelraw
milk bacterial isolates distribution and high ratio( 52%)of LAB isolateslwas observed in
cows with ≥6-<12 number oflparturition
Depending on genotypic identification results the high ratio (100%) of
positivelresults of 16S rDNA based PCR appeared in all of raw milk bacterial isolates
of cowslat second age group(≥9 - ˂15 year) , and the difference between the two
agelgroups stastically was not considered significant (P>0.05)..The number of
parturitionlhad اhigh significant effect (p< 0.001) on16S rDNA based PCR
positivelresults and high ratio(50%) of these results was observed inlcows with 1 - <
6 number oflparturition.Subsequent bacteriocin encoding geneslbased PCR analysis
of 16S rDNA genes based PCR positive LAB revealed that higher ratio of PCR
positive results (60.9%) was observed in EntlB followed by Nis encoding
genes(30.4%) . High significant difference(P<0.01) was observed amonglthe Nis, Ent
A and Ent B encoding genes based PCR positivelresults.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
447
INTRODUCTION
Cow’s milk has been a staple diet ever since the medical community publicized its
nutritional benefits in the 1920s (1). The microflora of raw milk often contains lactic acid
bacteria (LAB) ( 2). Food safety is one of the major concerns in public health due to
outbreaks of food-borne diseases ( 3).LAB produce various antimicrobial compounds,
which can be classified as low molecular mass compounds such as hydrogen peroxide,
carbon dioxide, diacetyl, uncharacterized compounds, and high molecular mass
compounds like bacteriocins (4).
Most of LAB bacteriocins are small thermostable or large thermolabile proteins or
protein complexes that display antimicrobial properties against other bacteria often
closely related gram positive bacteria, whereas producer cells are immune to their own
bacteriocin(s) ( 5). During the last decade, a great number of LAB bacteriocins have been
identified and their potential application as biopreservatives in foods or food products has
been explored ( 6).
LAB displaying antimicrobial activities could be used as natural biopreservatives to
prevent or inhibit the growth of pathogenic and spoilage bacteria and fungi. LAB also
preserves the nutritive qualities of various foods ( 7). This century has been a major effect
in describing, cataloging, and characterizing the wide variety of antagonistic compounds
produced by LAB ( 8). The preservative effect of LAB is due to the production of one or
more active metabolites, such as bacteriocins (nisin, reuterin, reutericyclin, pediocin,
lacticin, enterocin and others) and bacteriocin-like inhibitory substances-BLIS ( 9)
Although bacteriocins, in a sense, can be considered as antibiotics, they differ from
conventional antibiotics in numerous aspects (10). Bacteriocins are inherently tolerant to
higher thermal stress and are more active at a wider pH range than conventional
antibiotics. Development of resistant strains among their target bacteria is unlikely as
they have fast-acting antimicrobial mechanisms that are highly potent even at very low
concentrations. Furthermore, their proteinaceous nature minimizes resistance
development as they are easily degraded by proteolytic enzymes, thus lessening the
chances of target strains developing any resistance machinery. ( 10).This study aimed to
identify the lacticgacid bacteria that compose the microbiota of raw cow milk and their
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
448
bacteriocinogenic potential.And determinekspecific genes related to their bacteriocins
production.
MATERIALS AND METHODS
Samples collection and bacterial isolation
All studied samples were collected through period extended from November 2015 to
January 2016, including different animals farms in Basrah province .One hundred raw
cow’s milk samples were collected randomly from 100 healthy cows, All sample were
placed in to sterilized test tubes and transported on ice in cooler boxer to the laboratory
for subsequent analysis.One ml of milk transferred to 9 ml of MRS broth, Then 0.1 ml
was streaked on the surface of MRS agar. The MRS agar culture plates were incubated at
37 °C for 2 days under anaerobic condition ( 11).
Identification of LA
Phenotypic and genotypic identification of LAB from other bacteria. was done according to
the ( 11) .
Phenotypic identification
Phenotypic identification depend on Gram stain and catalase test
Genotypic identification
Genotypic identification was performed by PCR amplification of LAB16s rRNA
and bacteriocins encoding gens using specific primers(Table 1).The DNA of raw milk
bacterial isolates was extracted by using Wizard genomic DNA extraction and
purification kit(Qiagen)according to the manufacturer’sinstructions.
Amplificationlgenes encoded for LAB and its bacteriocin production andltheir
PCR prereaction mix were displayed in table (2).ThelPCR tubes were transferred to the
thermalcycler(Techne/UK) tostart thelamplification reaction according to
specificlprogram(Tables 3,4,5,6) for each gene (11).
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
449
Table (1): Primerlsequence used in PCR detection of bacteriocinogenic LAB
Primerlset Oligonucleotidelsequence Predicted
sizel
Referencesl
16s rRNA-F
16s rRNA-R
GCGGCGTGCCTAATACATGC
ATCTACGCATTTCACCGCTAC
700 bp Klijn et al., (12)
Nis-F
Nis-R
GGATAGTATCCATGTCTG
CAATGATTTCGTTCGAAG
250 bp Perin and
Nero(11)
enti A –F
enti A-R
CATCATCCATAACTATATTTG
AAATATTATGGAAATGGAGTGTAT
126 bp Toit et al., (13)
entB B–F
entB B–R
AAATATTATGGAAATGGAGTGTAT
GAAAATGATCACAGAATGCCTA
162 bp Toit et al., (13)
Table(2) The prereactionlmix (25 μl) for each16s rRNA, Nisin, enti A, enti B.
Materiall Sizel
DNA templatel 5 μll
Master mixl 12.5 μll
Primer forwardl 1 μll
Primer reversel 1 μll
Nuclease free waterl 5.5 μll
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
450
Table (3) : PCR conditionlfor 16s rRNA .
Table(4) : PCR conditionlfor Nisin.
Stagel
Setpsl Temperaturel Timel No. of
cyclesl
Firstl Denaturation 1l 95C˚l 5 minutsl 1l
Secondl
Denaturationl2 95C˚l 1 minutl
Annealingl 42l 1 minutl 30l
Extensionl1 72C˚l 1 minutl
Thirdl Extensionl2 72C˚l 10lmin. 1l
Stagel
Setpsl Temperaturel Timel No. of cyclesl
Firstl Denaturationl1 95C˚l 5 minutsl 1l
Secondl
Denaturation2 95C˚l 1 minut
Annealingl 55 C˚l 1 minutl 30l
Extensionl1 72C˚l 1 minutl
Thirdl Extensionl2 72C˚l 10 min.l 1l
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
451
Table (5) : PCRlcondition for ent A .
Table(6) : PCRconditionlfor ent B .
Stagea
Setpsa Temperaturea Timea No. of
cyclesa
Firsta Denaturation
1a
95C˚a 5
minutsa
1a
Seconda
Denaturation
2a
95C˚a
1 minuta
30a
Annealinga 56 C˚a 1 minuta
Extension 1a 72C˚a 1 minuta
Third Extension 2a 72C˚a 10amin. 1
Stagel
Setpsl Temperaturel Timel No. of
cyclesl
Firstl Denaturation
1a
95C˚a 5 minutsa 1a
Secondl
Denaturation
2a
95C˚
1 minuta
Annealinga 58 C˚a 1 minuta 30a
Extension 1a 72C˚a 1 minuta
Thirdl Extension 2a 72C˚a 10 min.a 1a
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
452
PCR resulthdetection
The results of the PCR were performed in post amplification from amplification
samples was loaded in a 1.5 % agarose gel containing 0.5 μl /25ml ethidium bromide
the gel was run at 70 V. the products were visualized by UV transillumination .
Statisticallanalysis
To demonstrate any associationlbetween results, the exact Fisher test and
Pearson'schi-squaredtestwithlYates correction were used with the limit of
significance being setlat 5%. Statistical analysis is done by using SPSS
softwarelversion 11.
RESULTSl
Phenotypic identification results
The LAB isolates which is characterizedby both Gram positive and catalase negative
reactions was observed in 51 % of cowsraw milk bacterial isolates with 51% an overall
ratio.The higher results of conventionallbacteriological analysis were observed in raw
milk bacterial isolates of cowslat first age group(≥3 - < 9 year) , particularly Gram
positive catalase negative LABlisolates which were appeare in a ratio of 58.5%.There
was significantleffect ( p< 0.05)for the cows age on the raw milk bacterial isolates
ldistribution .The number of parturition affect significantly ( p< 0.05) on thelraw milk
bacterial isolates distribution and high ratio( 52%)of LAB isolateslwas observed in cows
with ≥6-<12 number oflparturition(table7)
.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
453
Table( 7). Distribution of LABlisolates in cows raw milk according to
conventionallbacteriological analysis.
Genotypic identification results
Amplificationlof 16S rDNA Region:
After DNA isolation the 16S rDNA region waslamplified by PCR protocole. Then the
PCR products were visulized by agarosegellelectrophoresis under UV light. The length of
amplificationlproducts was700 bp (Figure 1).
Variablesl
Conventional bacteriologicallanalysis
Tested
isolates
Gram
Positive,
cocci
N(%)
Catalase
negative
Gram positive
catalase
nagative
Statisticall
analysis
Agelgrou
ps
(year)
≥3 - < 9 70 53(75.7) 47(67.1) 41(58.5) X²
18.437;DF:
5;P;
0.0024
≥9 - ˂15 30 18(60) 13(43.3) 10(33.3)
Total 100 71 60 51
Parturitio
n
numberl
1 - < 6 75 55(73.3) 40(53.3) 38(50.7) X²:12.29;D
F:5;P;
0.0309
≥6-<12 25 16(64)
20(80) 13(52)
Total 100 71 60 51
Basrah Journal of Veterinary Research,Vol.
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
Figure (1). 16S Amplification
bp DNA marker, lane (2
Distributionlof16S rDNA based
The high frequency(100% ) of
raw milk bacterial isolates of cows
difference between the two age
(P>0.05)..The number of
rDNA based PCR positive
observed inlcows with 1 -
L 1 2 3 4 5 6 7
500
100
200
300
400
600
700
15, No.3,2016
454
products of cows raw milk LAB isolates
-8) are positive LAB Isolates(700 bp).
16S PCR positive results
positivelresults of 16S rDNA based PCR
cowslat second age group(≥9 - ˂15
agelgroups stastically was not considered significant
.parturitionlhad extremily significant effect
positivelresults of the raw milk LAB and high ratio(
< 6 number oflparturition(table 8).
700 bp
solates lane (1 ) is 100
results appered in all of
year) , and the
groups had (p< 0.001) on16S
results 50%) was
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
455
Table (8): Distribution of 16S rDNA basedPCR positive results according to ageland
Parturition of cows:
Bacteriocinen coding genes:
Subsequent bacteriocin encoding geneslbased PCR analysis of 16S rDNA genes positive
LAB revealed that higher ratio of PCR positivity(60.9%) was observed in EntlBfollowed
byNis encoding genes(30.4%) .High significant difference(P<0.01) was observed
amonglthe Nis, Ent A and Ent B encoding genes based PCR positivelresults .Table 9 and
figures 2,3,4 lpresent the results for bacteriocin encodinglgenes in the LAB isolates of
cows.
Variablesl
16S rDNA genes based PCRl
n.(%)
LAB
Isolates
n.
Positive
16s rRNA
Negative
16s rRNA
Statisticall
analysis
Agelgroups
(year)
>3 - < 9 41 13(31.7) 28(68.3) X²:0.348;
df:1;
P:0.55
≥9 - ˂15 10 10(100) 0
Totall 51 23(45.1)
28(54.9)
Parturition
numberl
1 - < 6 38 19(50) 19(50) X²:17.043;
df:1;P:0.00
003654
≥ 6-<12 13 4(30.8) 9(69.2)
Totall 51 23(45.1) 28(54.9)
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
456
Table (9): Bacteriocin encodinglgenes based PCR results in LAB isolates of cows
raw milkl.
Bacteriocin encoding
genes based PCR
analysis
16SrDNA based PCR positive LAB
isolates
Examined
n.(%)
Positive
n.(%)
Negative
n.(%)
Nis
23 7(30.4)
16(69.6)
Ent A 23 2(8.7)
21(91.3)
Ent B 23 14(60.9)
9(39.1)
Test of significance X²:11.886;DF:2;P; 0.0026
Basrah Journal of Veterinary Research,Vol.
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
Figure 2. Enti A amplification
Lane (1 ) is 100 bp DNA marker, lane (2
M 1 2 3 4 5 6 7
100
200
300
400
500
600
700
15, No.3,2016
457
nti products of cows raw milk LAB Isolates
-5,7,8) are positive
126 bp
enti A( 126 bp)
Basrah Journal of Veterinary Research,Vol.
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
Figure 3. Enti B amplification Products of
bp DNA marker, lane (2,3,5
M 1 2 3 4 5 6 7
100
200
300
400
500
600
700
15, No.3,2016
458
nti cows raw milk LAB Isolates
2,3,5-8) are positive Enti B( 162 bp)
162 bp
lane (1 ) is 100
Basrah Journal of Veterinary Research,Vol.
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
Figure 4. Nis amplification
DNA marker, lane (2,3, 4,7,8) are positive
Modern applications of
two decades, importance
encouraged otherlcountries to make serious efforts to isolate and identify their local
LABs, andloptimize them for industrial applications..
many other scientists around the world
presentlstudy, the first important goal was to achieve a primary identification of local
LABslpresent in raw milk of local cows and evaluate their
M 1 2 3 4 5 6 7
100
200
300
400
500
15, No.3,2016
459
products of cows raw milk LAB Isolates Lane (1 ) is 100 bp
Nis ( 250 bp)
DISCUSSIONl
oflLABs have a long history in developed countries. In the past
importancelof these bacteria in industry and health improvement has
countries optimize applications..(14) in Malaysia ,
worldlhave been recently working on LABs. In the
study, present theirlbacteriocinog
250 bp
LABs of ,(15) in Egypt and
have bacteriocinogenic potentials.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
460
The results of isolation of cow raw milk using MRS medium had showed that out of 100
bacteriallisolates. 51 isolates. were considered as LAB characterized by lGram , negative
positive catalase, and able to live in anaerobic condition., Abdelgadir et al., (16);
Savadog et al., (17)supported the present result by their identification of LAB isolates in
fermented cow and lamb milk and they observed that the most dominant bacteria were
thoselfrom genus Lactobacillus.
PCR identificationkof LAB and bacteriocinogenic activity of isolatesl
Many studies highlighted thelabsence of adequate selectivity in the employed culture
media, even forlLAB Carr et al., (18); Perin and Nero. (11)).Accordingly genomic
DNAs of isolateslwere isolated using the method offered by DNA extraction kit
manufacturerlinformation then isolated DNAs were visulized by agarose gel
electrophoresis underlUV light. Then they were taken to the PCR step, All 51 isolates of
cowsl that presented positive Gram and negative catalase reactivity waslsubjected to 16S
rRNA based PCR identification.Twenty three cows raw milk isolates were identified
aslLAB.Thelemployement of 16S rRNA (700bp) in the identification of raw milk
LABlisolates by PCR was in agreement with Perin and Nero (11); Klijn et al., (12)
who l observed that sequencing of the V1 region (90 bp) of the 16S rRNA genelwas
sufficient to provide a proper and reliable identification of the isolates, withlvariations
that allowed differentiation of their species andlsubspecies. However, sequencing of the
same region in Enterococcus spp. isolateslwas not enough to provide a reliable
identification at the species level, askobserved in previous studies (19-21);
All lcows raw milk isolates presented at least one of the tested bacteriocin encoding
genes ; nolisolates presented Ent A, Ent B and Nis genes simultaneously.This finding was
inlagreement with study of Perin and Nero(11) in which 30 Enterococcuslisolates
presented at least one of the tested lantibiotic genes and no isolateslpresented lanB, lanC
and lanM simultaneously. In the current study, presenselof one bacteriocin gene in
raw milk bacterial isolates was supported by previouslstudies which was reported that
antimicrobial potential of the isolates was not affectedlby, the presence of at least one of
the tested genes,as one gene wouldlbe sufficient for lantibiotic production (22,
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
461
23).Inconclusion, Phenotypic and genotypic identifications were effectively identified the
LAB and the Phenotyic identifications support the genotypic characterization results and
bacteriocinogenic properties of isolated bacteria were determined by PCR.
التشخیص المظھری و الوراثی لبکتریا حامض اللاکتک المنتجھ للبکتریوسین المعزولھ من حلیب
الابقار
ھبة الرحمن ریاض ،فوزیھ علی عبدلله
فرع الاحیاء المجھریھ،کلیة الطب البیطری،جامعة البصره،البصره،العراق.
الخلاصھ
اظھرت نتائج التشخیص المظھری ان بکتریا حامض اللاکتک الموجبة الکرام وغیر المنتجھ لانزیم الکتلیز
تواجدھا لوحظ فی 51 نموذج من حلیب الابقار الخام وکانت نسبتھا الکلیھ % 51 . ولوحظت اعلى نتائج
58.5% )للاختبارات البکتریلوجیھ التشخیصیھ التقلیدیھ من العزلات البکتریھ المأخوذه من حلیب الابقار التی .)
على توزیع عزلات ( p< 3≤) سنھ، وکان لعمر الابقار تاثیر احصائی معنوی ( 0.05 - < تتراوح اعمارھا بین ( 9
على عزلات بکتریا حلیب ( p< البکتریا للحلیب الخام، کذلک کان لعدد الولادات تأثیر احصائی معنوی( 0.05
الابقار الخام، حیث لوحظت اعلى نسبھ (% 52 )لعزلات بکتریا حامض اللاکتک فی الابقار التی تکون عدد الولادات
≥6-< فیھا 12
16 ا S rDNA المعتمد على PCR اعتمادا على نتائج التشخیص الوراثی کانت اعلى نسبھ(% 100 ) لنتائج
9≤) وان الفرق بین الفئتین - ˂15 year) لموجبھ فی جمیع عزلات الحلیب الخام للابقار من الفئھ العمریھ الثانیھ
على (p< عدد الولادات کان لھ تاثیر عالی المعنویھ ( 0.001 .(P> العمریتین لم یعتبر ذو معنویھ احصائیھ.( 0.05
16 وا ن اعلى نسبھ(% 50 ) لھذه النتائج لوحظت فی الابقار التی لھا عدد S rDNA المعتمده على PCR نتائج
المعتمد على الجینات المشفره للبکتریوسین الذی اجری لاحقا على PCR 1). اظھرت نتائج تحلیل - < ولادات( 6
16 ان اعلى نسبھ(% 60.9 ) لنتائج S rDNA الموجبھ المعتمده على PCR جراثیم حامض اللاکتک ذات نتائج
وتلتھا نسبة (% 30.4 ) الجینات المشفره للنیاسین.لوحظ فرق احصائی EntlB الموجبھ قد لوحظت فی جینات PCR
.Ent B وEnt A الموجبھ المعتمده على الجینات المشفره للنیاسین و PCR عالی المعنویھ بین نتائج
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
462
.REFERENCES
1-Mendelson A. (2011). "In bacteria land": The battle over raw milk. Gastronomica : the
journal of food and culture 11:35-43
2- Hickey, C.D., Sheehan, J.J., Wilkinson, M.G. and Auty, M.A.E. (2015). Growth and
location of bacterial colonies within dairy foods using microscopy techniques: a review.
Frontiers in microbiology, vol. 6: 99.
3- Gyawali R and Ibrahim SA. Natural products as antimicrobial agents. Food Control
2014; 46: 412-429.
4- Mobolaji OA and Wuraola FO. Assesment of the antimicrobial activity of lactic acid
bacteria isolated from two fermented maize products-ogi and kunni-zaki. Malaysian
Journal of Microbiology 2011; 7(3): 124-128.
5- Zacharof MP and Lovitt RW. Bacteriocins produced by lactic acid bacteria.
APCBEE Procedia 2012; 2:50-56.
6- Cintas LM, Casaus MP, Herranz C, Nes I F and Hernández PZ. Review: Bacteriocins
of lactic acid bacteria. Food Sci. Tech. Int. 2001;7(4):281-305.
7- Ahmadova A, Todorov SD, Hadji-Sfaxi I, Choiset Y, Rabesona H, Messaoudi S,et al.
Antimicrobial and antifungal activities of Lactobacillus curvatus strain isolated from
homemade azerbaijani cheese’, Anaerobe 2013;20: 42-47.
8- Liu SQ. Practical implications of lactate and pyruvate metabolism by lactic acid
bacteria in food and beverage fermentations. International Journal of Food Microbiology
2003; 83: 115-131.
9- Favaro L, Penna AL and Todorov DD. Bacteriocinogenic lab from cheeses -
Application in biopreservation. Trends in Food Science Technology 2015; 41: 37-48.
10- Perez RH, Zendo T and Sonomoto K. Novel bacteriocins from lactic acid bacteria
with various structures and applications. Microbial Cell Factories 2014;13(Suppl1): S3.
11- Perin L M and Nero L A. Antagonistic lactic acid bacteria isolated from goat milk
and identification of a novel nisin variant Lactococcus lactis . BMC Microbiology 2014;
14:36.
12-Klijn N, Weerkamp AH and de Vos WM. Identification of mesophilic lactic acid
bacteria by using polymerase chain reaction-amplified variable regions of 16S rRNA and
specific DNA probes. Appl. Environ Microbiol 1991; 57(11):3390–3393.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
463
13-Toit MD, Franz CMAP, Dicks LMT and Holzapfel WH. Preliminary characterization
of bacteriocins produced by Enterococcus faecium and Enterococcus faecalis isolated
from pig faeces. J. Appl. Microbiol 2001; 88(3):482–494.
14-Tannaz Jalilsood1, Ali Baradaran1, Adelene Ai‑Lian Song1, Hooi Ling Foo2,3,
Shuhaimi Mustafa4,5, Wan Zuhainis Saad4,6, Khatijah Yusoff3,4 and Raha Abdul
Rahim1. Inhibition of pathogenic and spoilage bacteria by a novel
biofilm‑formingLactobacillus isolate: a potential host for the expression of heterologous
proteins. Jalilsood et al.Microb Cell Fact 2015; 14:96.
15-Eman N A and Asmaa B M B T. Identification of Lactic Acid Bacteria in Raw Milk
and Kariesh Cheese with Special Reference to Lactococcus garvieae. Journal of Food
and Nutrition Sciences 2015; 3(6): 203-208.
16-Abdelgadir W S, Hamed S , Moller S, Jakobsen P L. Characteristics of The Dominant
Microbiota of Sudanese Fermented Milk Rob. Int. Dairy Journal 2001; Vol 11 : 63-70.
17-Savadogo A, Quanttara C A T, Savadogo P W, Quatta A S, Barro N and Traore A S.
Microorganisms involved in Fulani Traditional fermented milk in Burkania Faso.
Pakistan Journal of Nutrition2004; 3 (2): 134- 139.
18-Carr FJ, Chill D and Maida N. The lactic acid bacteria: a literature survey. Crit. Rev.
Microbiol 2002; 28(4):281–370.
19-Campos CA, Rodríguez Ó, Calo-Mata P, Prado M and Barros-Velázquez J.
Preliminary characterization of bacteriocins from Lactococcus lactis, Enterococcus
faecium and Enterococcusmundtii strains isolated from turbot (Psetta maxima). Food
Res. Int. 2006; 39(3):356–364.
20-Giraffa G and Neviani E. DNA-based, culture-independent strategies for evaluating
microbial communities in food-associated ecosystems. Int. J. Food Microbiol 2001;
67(1):19–34.
21-Moraes PM, Perin LM, Silva A Jr and Nero LA. Comparison of phenotypic and
molecular tests to identify lactic acid bacteria. Braz. J. Microbiol 2013; 44(1):109–112.
22-Hyink O, Balakrishnan M and Tagg JR. Streptococcus rattus strain BHT produces
both a class I two-component lantibiotic and a class II bacteriocin. FEMS Microbiol Lett.
2006; 252(2):235–241.
23-Wirawan RE, Klesse NA, Jack RW and Tagg JR. Molecular and genetic
characterization of a novel nisin variant produced by Streptococcus uberis. Appl Environ
Microbiol 2006; 72(2):1148–1156.
journal of food and culture 11:35-43
2- Hickey, C.D., Sheehan, J.J., Wilkinson, M.G. and Auty, M.A.E. (2015). Growth and
location of bacterial colonies within dairy foods using microscopy techniques: a review.
Frontiers in microbiology, vol. 6: 99.
3- Gyawali R and Ibrahim SA. Natural products as antimicrobial agents. Food Control
2014; 46: 412-429.
4- Mobolaji OA and Wuraola FO. Assesment of the antimicrobial activity of lactic acid
bacteria isolated from two fermented maize products-ogi and kunni-zaki. Malaysian
Journal of Microbiology 2011; 7(3): 124-128.
5- Zacharof MP and Lovitt RW. Bacteriocins produced by lactic acid bacteria.
APCBEE Procedia 2012; 2:50-56.
6- Cintas LM, Casaus MP, Herranz C, Nes I F and Hernández PZ. Review: Bacteriocins
of lactic acid bacteria. Food Sci. Tech. Int. 2001;7(4):281-305.
7- Ahmadova A, Todorov SD, Hadji-Sfaxi I, Choiset Y, Rabesona H, Messaoudi S,et al.
Antimicrobial and antifungal activities of Lactobacillus curvatus strain isolated from
homemade azerbaijani cheese’, Anaerobe 2013;20: 42-47.
8- Liu SQ. Practical implications of lactate and pyruvate metabolism by lactic acid
bacteria in food and beverage fermentations. International Journal of Food Microbiology
2003; 83: 115-131.
9- Favaro L, Penna AL and Todorov DD. Bacteriocinogenic lab from cheeses -
Application in biopreservation. Trends in Food Science Technology 2015; 41: 37-48.
10- Perez RH, Zendo T and Sonomoto K. Novel bacteriocins from lactic acid bacteria
with various structures and applications. Microbial Cell Factories 2014;13(Suppl1): S3.
11- Perin L M and Nero L A. Antagonistic lactic acid bacteria isolated from goat milk
and identification of a novel nisin variant Lactococcus lactis . BMC Microbiology 2014;
14:36.
12-Klijn N, Weerkamp AH and de Vos WM. Identification of mesophilic lactic acid
bacteria by using polymerase chain reaction-amplified variable regions of 16S rRNA and
specific DNA probes. Appl. Environ Microbiol 1991; 57(11):3390–3393.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
463
13-Toit MD, Franz CMAP, Dicks LMT and Holzapfel WH. Preliminary characterization
of bacteriocins produced by Enterococcus faecium and Enterococcus faecalis isolated
from pig faeces. J. Appl. Microbiol 2001; 88(3):482–494.
14-Tannaz Jalilsood1, Ali Baradaran1, Adelene Ai‑Lian Song1, Hooi Ling Foo2,3,
Shuhaimi Mustafa4,5, Wan Zuhainis Saad4,6, Khatijah Yusoff3,4 and Raha Abdul
Rahim1. Inhibition of pathogenic and spoilage bacteria by a novel
biofilm‑formingLactobacillus isolate: a potential host for the expression of heterologous
proteins. Jalilsood et al.Microb Cell Fact 2015; 14:96.
15-Eman N A and Asmaa B M B T. Identification of Lactic Acid Bacteria in Raw Milk
and Kariesh Cheese with Special Reference to Lactococcus garvieae. Journal of Food
and Nutrition Sciences 2015; 3(6): 203-208.
16-Abdelgadir W S, Hamed S , Moller S, Jakobsen P L. Characteristics of The Dominant
Microbiota of Sudanese Fermented Milk Rob. Int. Dairy Journal 2001; Vol 11 : 63-70.
17-Savadogo A, Quanttara C A T, Savadogo P W, Quatta A S, Barro N and Traore A S.
Microorganisms involved in Fulani Traditional fermented milk in Burkania Faso.
Pakistan Journal of Nutrition2004; 3 (2): 134- 139.
18-Carr FJ, Chill D and Maida N. The lactic acid bacteria: a literature survey. Crit. Rev.
Microbiol 2002; 28(4):281–370.
19-Campos CA, Rodríguez Ó, Calo-Mata P, Prado M and Barros-Velázquez J.
Preliminary characterization of bacteriocins from Lactococcus lactis, Enterococcus
faecium and Enterococcusmundtii strains isolated from turbot (Psetta maxima). Food
Res. Int. 2006; 39(3):356–364.
20-Giraffa G and Neviani E. DNA-based, culture-independent strategies for evaluating
microbial communities in food-associated ecosystems. Int. J. Food Microbiol 2001;
67(1):19–34.
21-Moraes PM, Perin LM, Silva A Jr and Nero LA. Comparison of phenotypic and
molecular tests to identify lactic acid bacteria. Braz. J. Microbiol 2013; 44(1):109–112.
22-Hyink O, Balakrishnan M and Tagg JR. Streptococcus rattus strain BHT produces
both a class I two-component lantibiotic and a class II bacteriocin. FEMS Microbiol Lett.
2006; 252(2):235–241.
23-Wirawan RE, Klesse NA, Jack RW and Tagg JR. Molecular and genetic
characterization of a novel nisin variant produced by Streptococcus uberis. Appl Environ
Microbiol 2006; 72(2):1148–1156.