Document Type : Research Paper
Authors
1 Department of Clinical Laboratory Science, College of Pharmacy, University of Basrah.
2 Department of Microbiology, College of Veterinary Medicine, University of Basrah.
3 Department of Pharmaceutical Chemistry, College of Pharmacy, University of Basrah. Basrah, Iraq.
Keywords
Article Title العربیة
--
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
223
MOLECULAR DETECTION OF TETRACYCLINE RESISTANCE GENES
IN Bacillus cereus ISOLATED FROM FOOD SOURCES
Ban M.S. Saeed*, Basil A. Abbas**, Shaker A.N.Al-jadaan***
*Department of Clinical Laboratory Science, College of Pharmacy, University of Basrah.
** Department of Microbiology, College of Veterinary Medicine, University of Basrah.
***Department of Pharmaceutical Chemistry, College of Pharmacy, University of Basrah.
Basrah, Iraq.
keywords : Bacillus cereus, Tetracycline resistance, tet K.
Corresponding author: ban.saeed@ uobasrah.edu.iq
ABSTRACT
Two hundreds of different food samples i.e. cream, beef meat, frozen beef meat, burger,
cooked rice and minced rice were collected from local markets in Basrah city. The tested
samples of each food type were found to be contaminated with Bacillus cereus (B. cereus) in a
ratio of 36.36 % for cream, 26.47 % for beef meat, 50 % for frozen beef meat, 36.36 % for
burger, 18.18 % for cooked rice and 51.51 % for minced rice. Mannitol egg-yolk agar (MYP)
supplemented with polymyxin B sulfate is a selective media used for isolation. Identification of
the isolate was done by detection of 16SrDNA and conformed by sequencing. Antimicrobial
susceptibility test was used for screening the isolates, which were resistance to tetracycline.
Bacillus cereus isolates were resistance to tetracycline TE 30 mg/disc (100 %) in cream and (0
%) in cooked rice. Polymerase chain reaction was used for detection of the presence of
tetracycline resistance gene in the percentage 32 % and 44% for tet (K) and tet (L), respectively.
INTRODUCTION
Bacillus cereus is a gram positive, rod shaped and spores forming bacterium that causes
severe food poisoning in human. The spores can stay alive in hot and dry conditions, and remain
dormant for many years (1). B. cereus causes two types of food poisoning in humans: the
diarrhoeal (thermo labile toxin) and emetic (thermo stabile toxin) type. Both types can seriously
affect human health (2), causing severe infections including sepsis, meningitis, endocardititis,
endophthalmitis, respiratory and surgical wound infections (3). Recently B. cereus was
connected to hospital infection (4). Diarrheal disease has been a major public health problem in
several countries causing high morbidity and mortality among children (5). Tetracycline (TC) is
a broad-spectrum antibiotic used in the treatment of bacterial infections in humans, animals, and
insects. Therefore, bacteria from different ecosystems are exposed to this antibiotic leading to
antibiotic resistance (6). Three main mechanisms of resistance to tetracycline that is, energydependent
efflux, protection of the bacterial ribosome, and enzymatic inactivation of the
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
224
tetracycline molecule (6). B. cereus have been shown to carry the tet(L) gene on a plasmid, while
other species of Bacillus carry either tet(L) or tet(K) on plasmids, and/or in the chromosome (7-
9). Both of these genes can on occasion be mobilized in the presence of conjugative plasmids but
are not themselves able to independently transfer thus slowing their spread within the population.
The tet(K) and tet(L) genes encode efflux proteins which pump tetracycline and doxycycline out
of the cell. These genes are commonly found in specific Gram-positive genera (10). The aim of
this study is the isolation and identification of Bacillus cereus isolates from different food
samples which cause food poisoning and determinates the tetracycline resistance genes in these
isolates.
MATERIALS AND METHODS
Samples collection
A total of 200 samples of cream, beef meat, frozen beef meat, rice cereals, cooked rice and
burger were collected from different local markets in Basrah city from February to April, 2018.
All samples were collected in sterile container, kept in icebox and transferred immediately to the
laboratory where they were prepared and examined for the presence of Bacillus cereus (11).
Isolation of B. cereus
The samples were transferred in peptone water ( peptone water used to avoid the strain
variation and keep the strain a live as possible, peptone water (oxoid ) 0.1%, PH 7.0, was
prepared and used as a diluent ). One gram from each sample i.e. burger, cream, beef meat,
frozen beef meat, rice cereals and cooked rice transferred to 10 ml of 0.1 % peptone water. Then
0.1 ml was streaked on the surface of MYP agar, spread by sterile L – shape. The MYP agar
culture plates were incubated at 35 °C for 2 days (12). Colony morphology and Gram's stain
were conducted to suspected bacteria. A typical B. cereus colonies on Mannitol Egg Yolk Agar (
MYP ) supplemented with polymyxin B sulfate ( Himedia ), are surrounded by a precipitated
zone which indicates lecithenase activity and a pink color is observed because mannitol is not
fermented (13).
Identification of B. cereus
The identification is done by 16S rDNA partial sequence (14).
DNA Extraction
Genomic DNA for PCR was purified from bacterial cells cultured in brain heart infusion
broth ( oxoid ) using commercial kit, and following the protocol provided by the manufacture (
Geneaid ). DNA samples were stored at -20°C until used.
PCR Amplification
The amplification of the 16S rDNA is done by (PCR) using universal primers and PCR
conditions described by (15). The oligonucliotide primers which were used have 1541 bp and
their sequence are :
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
225
16S rDNA F: AGAATTTGATCCTGGCTTAG
16S rDNA R: AAGGAGGTGATCCAGCC
PCR mixture contained 25 μl of PCR green master mix ( Promega ), 2 μl of each primer
(BioNeer) and10 μl of template DNA in a total volume of 50 μl with free water. The cycling
conditions were initial denaturation at 94°C for 10 min, followed by 35 cycles of denaturation
step at 94°C for 1 min., annealing step at 54.7°C for 1 min, extension step at 72°C for 1min, and
final extension step at 72°C for 10 min (15). PCR products were detected in 1.5 % agarose gel
stained with ethidium bromide ( 0.5μg/ml ), viewed by U.V. transillumination and photographed
(15).
Tetracycline resistance test
The tetracycline resistance testing was determined by the disk agar diffusion method (16). B.
cereus isolates were tested for resistance to tetracycline disk 30μg (Bioanalyse).
Detection of tet (K) and tet (L) genes by PCR
Tetracycline resistance genes tet (K) and tet (L) were detected by PCR. The primers used in
this study were:
tet (K) F : TCG ATA GGA ACA GCA GTA,
tet ( K) R : CAG CAG ATC CTA CTC CTT
tet (L) F : TCG TTA GCG TGC TGT CAT TC
tet (L) R: GTA TCC CAC CAA TGT AGC CG
These primers are for forword and reverse for tet (K) and tet (L), respectively (17). PCR
mixture contained 12.5 μl of PCR green master mix (Promeg ), 1 μl of each primer (BioNeer )
and 5 μl of template DNA in a total volume of 25 μl with free water. For tet (K) gene, the cycling
conditions were initial denaturation at 94°C for 5 min, followed by 35 cycles of denaturation step
at 94°C for 1 min., annealing step at 48°C for 1 min, extension step at 72°C for 1.5 min, and final
extension step at 72°C for 10 min. For tet (L) gene, the cycling conditions were initial
denaturation at 94°C for 5min, followed by 35 cycles of denaturation step at 94°C for 1 min.,
annealing step at 56°C for 1 min, extension step at 72°C for 1min, and final extension step at
72°C for 10 min (17). PCR products were detected in 1.5 % agarose gel stained with ethidium
bromide ( 0.5μg/ml ), viewed by U.V. transillumination and photographed.
RESULTS
A total of 200 samples were collected from local markets in Basrah city. The tested samples
of each food were contaminated with B. cereus in a ratio of 36.36 % for cream, 26.47 % for beef
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
226
meat, 50 % for frozen beef meat, 36.36 % for burger, 18.18 % for cooked rice, and 51.51 % for
minced rice (Table 1).
Table (1) Number and percentage of Cream, Beef meat, Frozen beef meat, Burger, Cooked
rice and Minced rice having B. cereus isolates
Sample
No. of samples
Positive sample
No. %
Cream 33 12 36.36
Beef meat 34 9 26.47
Frozen beef meat 34 17 50
Burger 33 12 36.36
Cooked rice 33 6 18.18
Minced rice 33 17 51.51
Total 200 73 36.5
P < 0.05
Figure1: Identification of Bacillus cereus by detection of 16S rDNA
Lane M1= Ladder, Lane = 1 – 8 positive for 16S rDNA 1541 bp, Lane 9 = negative control.
The colony morphology on MYP medium was violet – red background and surrounded by an
egg-yolk precipitate. In microscopic examination, the bacterium is gram positive, rod bacilli and
spore forming. All B. cereus isolates distributed in cream, beef meat, frozen beef meat, burger,
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
227
cooked rice, minced rice, were identified by 16S rDNA with similarity of 80%-100% (Table2)
when it blast in the NCBI data base (Figure 1) shown the amplicons of B. cereus isolates using
16s rDNA universal primers which produced 1541 bp in size.
Bacillus cereus isolates were resistance to tetracycline TE 30 mg/disc ( 100 % ) in cream and
(0%) in cooked rice. Table 3, Figure 2.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
228
Table (3) Antimicrobial susceptibility of Bacillus cereus isolates against tetracycline
antimicrobial disk
The isolates type
No. of
isolates
N= 39
No. of isolates
No. of S S% No. of R R%
Cream 6 0 0% 6 100 %
Beef meat 6 4 66.66 % 2 33.33 %
Frozen beef meat 5 3 60 % 2 40 %
Burger 7 1 14.28 % 6 85.71 %
Cooked rice 5 5 100 % 0 0 %
Minced rice 10 1 10 % 9 90 %
Total 39 14 35.89 % 25 64.10 %
P < 0.05
S: susceptible , R: resistance
Figure2: Tetracycline resistance test
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
229
Tetracycline resistance gene investigations were done by PCR. Tet (K) gene was detected in 8
out of 25 isolates (32 %), distributed in cream, beef meat, frozen beef meat, burger and minced
rice in 50%, 0%, 100%, 33.33% and 11.11%, respectively. But this gene was not detected in both
of frozen beef meat and cooked rice. Table 4, Figure 3
Table (4) Detection of tetracycline resistance ( tet K ) gene in Bacillus cereus
isolates
Sample
Isolate Positive tet K %
Cream 6 3 50 %
Beef meat 2 2 100 %
Frozen beef meat 2 0 0 %
Burger 6 2 33.33 %
Minced rice 9 1 11. 11 %
Total 25 8 32 %
P > 0.05
Figure3: Detection of tetracycline resistance gene tet (K).
Lane M1, M2 = ladder, Lane 1-8 = positive for tet K gene 169 bp, Lane 9= negative control
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
230
Tet (L) gene was detected in 6 out of 25 isolates (44 %), distributed in cream, beef meat, frozen
beef meat, burger and minced rice in 33.33%, 50% 50%, 83.33% and 22.22%, respectively. But
this gene was not detected in cooked rice. Table 5, Figure 4.
Table (5) Detection of tetracycline resistance tet( L ) gene in Bacillus cereus
isolates
Sample Isolate Positive tet L %
Cream 6 2 33.33 %
Beef meat 2 1 50 %
Frozen beef meat 2 1 50 %
Burger 6 5 83.33 %
Minced rice 9 2 22.22 %
Total 25 11 44 %
P > 0.05
Figure 4: Detection of Tetracycline resistance gene tet (L)
Lane M1, M2= Ladder, Lane 1- 4, 6= positive for tet (L) gene 267 bp, Lane 5= negative for tet (L) gene, Lane 7=
negative control
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
231
DISCUSSION
Bacillus cereus is an opportunistic pathogen causing severe food poisoning. The poisoning
manifested by diarrhoeal or emetic syndrome (18). This study revealed a high incidence of B.
cereus in food sources in a percentage of 36.36 %, 26.47 % , 50 %, 36.36 % , 18.18 % , and
51.51 % for cream, beef meat, frozen beef meat, burger , cooked rice and minced rice ,
respectively. The result agreed with Schlegelova et. al,. 2003, who reported that the
contamination with B. cereus strains was recorded in 31% of all dairy products (66 samples), and
in 28% of samples (31 samples) of meat products (18). The recorded prevalence of strains in the
foodstuffs examined is not at variance with characteristic properties of B. cereus. That is also
reported that products made from skimmed milk (curd cheese) were contaminated in one case
only (3.2% of products), while products with higher fat content (even if made with different
production technologies) in 10–16% of cases (19).
Antibiotic resistance is a major health problem during past time. It developed from resistance
to single classes of antibiotics to multidrug resistance and extreme drug resistance. Spreading of
resistance genes due to their relocation from the chromosomes of environmental bacteria to a
mobile element and then to clinical pathogens (20- 24). The antibiotics are getting worth now
days and due to number of clinical concerns their usage is important and there is still need of
research for the new discoveries (25).
Our study indicates that Bacillus cereus isolates were resistance to tetracycline TE 30 mg/disc
( 100 % ) in cream and (0 %) in cooked rice. A relatively higher phenotypic resistance against
tetracycline (64.10%) was noted compared to the studies of Schlegelova et. al., (26,27) and
Whong and Kwaga (28), who found 3.03% and 6.7% of B. cereus isolates resistance against
tetracycline, respectively, therefore the isolates were screened for presence of tetracycline
resistance genes. Ankolekar et. al., (29), reported tetracycline resistance in 49 of the strains
(98%), and also Chaves et. al., (30) also found predominant resistance to tetracycline, whereas a
total of 26 strains were found to be susceptible to tetracycline with a rate of 89.7% (31).
This project could be easily extended to other classes of antibiotic resistance genes to
understand the pathways leading to acquisition of drug resistance by human- and animalpathogenic
bacteria (32). The main goal of this study is to continuing the previous studies
(33,34,35) and isolation and identification of Bacillus cereus from different samples and
determinates the tetracycline resistance genes in these isolates.
ACKNOWLEDGMENT
We are great thankful to Prof. Dr. Rahman Dep. of Medicine, College of Veterinary
Medicine, University of Basrah, for his assistance in statistics analysis.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
232
REFERENCE
1. Henriques, A.O. and Moran, Jt. C. (2007). Structure, assembly and function of the spore
surface layers. Annual preview of Microbiology. 61:555- 588.
2. Ehling-Schulz, M.; Guinebretiere, M.H.; Monthan, A.; Berge, O.; Fricker, M. and
Sverisson, B.( 2006). Toxin gene profiling of enterotoxic and emetic Bacillus cereus.
FEMS Microbiol. Lett. 260(2): 232-240.
3. Ginsburg, A.S.; Salazar, L.G.; True, L.D. and Disis, M.L. (2003). Fatal Bacillus cereus
sepsis following resolving neutropenic enterocolitis during the treatment of acute leukemia.
Am. J. Hematol. 72(3): 204-208.
4. Dancer, SJ. (1999). Mopping up hospital infection. J Hosp Infect . 43(2): 85−100.
5. Bureau of Epidemiology. Siluation of diarrhea disease. Bangok, Thailand: Department of
Disease Control, Ministry of Public Health; 2004.
6. Roberts, MC.(1996). Tetracycline resistance determinants: mechanisms of action,
regulation of expression, genetic mobility, and distribution. FEMS Microbiol Rev. 19: 1-
24.
7. Bernhard, K.; Schrempf, H. and Goebel, W. (1978). Bacteriocin and antibiotic
resistance plasmids in Bacillus cereus and Bacillus subtilis. J. Bacteriol. 133:897-903.
8. Eccles, S.J. and Chopra, I. (1984). Biochemical and genetic characterization of the tet
determinant of Bacillus plasmid pAB124. J. Bacteriol. 158: 134-140.
9. Ives, C.L. and Bott, K.F. (1989). Cloned Bacillus subtilis chromosomal DNA mediates
tetracycline resistance when present in multicopies. J. Bacteriol. 171: 1801-1810.
10. Chopra, I. and Roberts, M. (2001). Tetracycline antibiotics: mode of action,
applications, molecular biology, and epidemiology of bacterial resistance. Microbiol. Mol.
Biol. Rev. 65: 232-260.
11. Abd, A.; Abdul-Alelah, N., I. and Abdul-Alrazak, O. (2010). Morrphological and
microscopical comparison features of Bacillus cereus isolates. Kufa J. Vet. Med. Sci. 1: 27-
37.
12. van Netten, P. and Kramer, J. M. (1992). Media for the detection and enumeration of
Bacillus cereus in foods: a review. Intl. J. Food Microbiol. 17: 85-99.
13. Food Drug Administration- FDA (1980). Bacteriological analytical manual. 8. ed.
Arlingtoni FDA; AOAC,. chap. 14.
14. Nisreen Jawad, Sahilah Abd. Mutalib and Aminah abdullah (2016). Antimicrobial
resistance pattern of Bacillus cereus strains isolated from fried rice samples. ChemTech
Res. 9(1).160-167.
15. Richard, D. and Sherry, S. W. (2004). Amplification of ribosomal RNA sequences.
Molecular Microbial Ecology Manual, Second Edition 3.01: 509–522.
16. Bauer, A. W; Kirby, W. M. and Sherris, J. C. (1966). Antibiotic susceptibility testing by
a standard single disk method. American Journal of Clinical Pathology. 45: 493-496.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
233
17. Warsa, U. C., Nonoyama, M., Ida, T., Okamoto, R. (1996). In aerobically grown
Escherichia coli. Journal of BacOkubo, T., Shimauchi, C., et al. Detection of teriology
170: 1423–9. tet(K) and tet(M) in Staphylococcus aureus of Asian.
18. Hemalatha, S. and Banu, N. (2010). DNA fingerprinting of Bacillus cereus from diverse
sources by restriction fragment length polymorphism analysis. Adv. in Biosc. and Biotech.
1: 136-144.
19. Schlegelova, J.; Brychta, J.; Klemova, E.; Napravnikova, E. and Babak, V. (2003).
The prevalence of and resistance to antimicrobial agents of Bacillus cereus isolates from
foodstuffs. Vet. Med. – Czech, 48. (11): 331–338.
20. Benveniste, R. and Davies, J. (1973). Aminoglycoside inactivating enzymes in
actinomycetes similar to those present in clinical isolates of antibiotic resistance bacteria.
Proc. Natl. Acad. Sci. U. S. A. 70:2276 –2280.
21. Lesmana M, et al. (2001). In vitro antibiotic susceptibility of Neisseria gonorrhoeae in
Jakarta, Indonesia. Antimicrob. Agents Chemother. 45:
359–362.
22. Manson, JM.; Hancock, LE. and Gilmore, MS. (2010). Mechanism of chromosomal
transfer of Enterococcus faecalis pathogenicity island, capsule, antimicrobial resistance,
and other traits. Proc. Natl. Acad. Sci. U. S. A. 107: 12269–12274.
23. Mayers, DL. (2009). Antimicrobial drug resistance, vol 1. Mechanisms of drug resistance
(infectious disease). Springer, Dordrecht, The Netherlands.
24. Nordmann, P. and Poirel, L.( 2005). Emergence of plasmid-mediated resistance to
quinolones in Enterobacteriaceae. J. Antimicrob. Chemother. 56:463– 469.
25. Gupta, M.K.; Gauri, S. and Shrivastava, A. (2013). Assessment of animicrobial potential
of Bacillus cereus isolated from extreme environmental condition. J. Microbiol. Biotech.
Res. 3 (2):58-63.
26. Schlegelova, J.; Brychta, J.; Klimova, E.; Napravnikova, E. and Babak V. ( 2008).The
prevalence of and resistance to antimicrobial agents of Bacillus cereus isolates from
foodstuffs. Vet Med Czech . 48: 331-338.
27. Vijayakumar, A.; Duraipandiyan, V.; Jeyaraj, B.; Agastian, P.; Karunai Raj, M. and
Ignacimuthu, S. ( 2012). Phytochemical analysis and in vitro antimicrobial activity of
Illicium griffithii Hook. f. & Thoms extracts. Asian Pac J Dis . 2(3): 190-199.
28. Whong, CMZ. and Kwaga, JKP. ( 2007). Antibiograms of Bacillus cereus isolates from
some Nigerian foods. Nigerian Food J 2007; 25: 178-183.
29. Ankolekar, C.; Rahmati, T. and Labbe, RG. (2009). Detection of toxigenic Bacillus
cereus and Bacillus thuringiensis spores in U.S. rice. Int J Food Microbiol. 128:460e6.
30. Chaves, JQ.; Pires, ES. and Vivoni, AM. (2011). Genetic diversity, antimicrobial
resistance and toxigenic profiles of Bacillus cereus isolated from food in Brazil over three
decades. Int. J. Food Microbiol .147:12e6.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
234
31. Arslan, S.; , Eyi, A. and Rümeysa Küçüksarı, R. (2014). Toxigenic genes, spoilage
potential, and antimicrobial resistance of Bacillus cereus group strains from ice cream.
Anaerobe 25: 42-46.
32. Aminov R. I.; Garrigues-Jeanjean N., and Mackie, R. I. (2001). Molecular ecology of
tetracycline resistance: development and validation of primers for detection of tetracycline
resistance genes encoding ribosomal protection proteins. App. and Envir. Microbiol. 22-
23.
33. Khudor , M. H.; Abbas, B. A. and Saeed, B. M. S. (2012). Molecular detection of
enterotoxin (cyt k) gene and antimicrobial susceptibility of bacillus cereus isolates from
milk and milk products. Basrah J. Vet. Research.11:164-173.
34. Abbas, B. A.; Khudor, M. H. and Saeed, B. M.S. (2012). Molecular detection of bacillus
cereus emetic toxin gene by pcr and determine its susceptibility against punica granatum
extracts. Basrah J.of Vet.Rresearch , vol. 11, 4,2012 Proceedings of the 3rd international
Scientific Conference.
35. Abbas, B. A. ; Khudor, M. H. and Saeed, B. M.S. Saeed (2014). Detection of hbl, nhe and
bceT toxin genes in bacillus cereus isolates by multiplex PCR. Int. J. Curr. Microbiol. App.
Sci. 3: 1009-1016.
| Article View | 333 |
| PDF Download | 284 |