COMPARISON OF THE EFFICACY OF DIFFERENT METHODS IN THE DIAGNOSIS OF BABESIOSIS IN CAMELS(Camelusdromedarius) IN ALNAJAF AL-ASHRAF PROVINCE-IRAQ OF NAJAF - IRAQ

Document Type : Research Paper

Authors

Department of Parasitology, College of Veterinary Medicine, University of Baghdad, Iraq.

Abstract
This study was designed to evaluate the effectiveness of microscopy compared to molecular
detection of babesiosis infection in camels(Camelus dromedarius) in AL- Najaf AL-Ashraf
province-Iraq, started from November 2017 to May 2018.The results showed that the total
prevalence using via microscopic examination and molecular detection method was 17.5%
,54.16% respectively,however , the rate of females infection was 10% as compared with males
25% by microscopic examination , whereas, the infection rate by using PCR in females and
males, 66.66% ,41.66% respectively. The results also showed that the rate of infection in the age
of less thana year was 6.66% and 28.33% in age of more than one year by microscopical
examinations, While by using the molecular assay the rate of infection in the age of less than a
year was 45% and 63.33% in the age of more than one year.It has been conclude that PCR has a
high ability to detect babesiosis in camels as compared with microscopic examination.

Keywords

Crossmark

Article Title العربیة

--

Abstract العربیة

--

Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
593
COMPARISON OF THE EFFICACY OF DIFFERENT METHODS IN THE
DIAGNOSIS OF BABESIOSIS IN CAMELS(Camelusdromedarius) IN ALNAJAF
AL-ASHRAF PROVINCE-IRAQ OF NAJAF - IRAQ
Azhar Ali Faraj ,Amer Murhum Abd AL-Amery
Department of Parasitology, College of Veterinary Medicine, University of Baghdad, Iraq.
Keywords: AL- Najaf , Camelus dromedaries, Babesiosis.
Corresponding Author: m.murhum@yahoo.com
ABSTRACT
This study was designed to evaluate the effectiveness of microscopy compared to molecular
detection of babesiosis infection in camels(Camelus dromedarius) in AL- Najaf AL-Ashraf
province-Iraq, started from November 2017 to May 2018.The results showed that the total
prevalence using via microscopic examination and molecular detection method was 17.5%
,54.16% respectively,however , the rate of females infection was 10% as compared with males
25% by microscopic examination , whereas, the infection rate by using PCR in females and
males, 66.66% ,41.66% respectively. The results also showed that the rate of infection in the age
of less thana year was 6.66% and 28.33% in age of more than one year by microscopical
examinations, While by using the molecular assay the rate of infection in the age of less than a
year was 45% and 63.33% in the age of more than one year.It has been conclude that PCR has a
high ability to detect babesiosis in camels as compared with microscopic examination.
INTRODUCTION
Babesia species anapicomplexan–hemoprotozoan parasite transmitted by Ixodidae ticks,they
refer to that more than 100 species have been phenotypically documented (1,2).This parasite is
considered a destructive affecting livestock production (3). And the infection is of global
importance which are characterized anemia, icterus, hemoglobin urea, muscles trembling,
grinding of teeth(4). The feces are dry and bloody stained, dehydration causes the eye to become
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
594
sunken in their sockets, falls of body temperature to a subnormal level before a few hours of
death , anemia , anorexia , death of untreated cases (5).
Diagnosis of hemoprotozoanparasite is beneficial in early diagnosis. conventionally, microscopic
examination has been considered the “gold standard” for diagnosis piroplasmosis in blood smear
in acute cases of infected animals but not in chronic cases(6,7).Therefore,proven efficacy and
sensitivity of molecular tests in detectionof Babesiasp. (8,9).The aim of this study to evaluate the
traditional methods compared to molecular detection for the diagnosis Babesia spp. in camels in
AL- Najaf AL-Ashraf province-Iraq.
MATERIALS AND METHODS
Blood Samples
120 camel’s blood samples (60 females and 60males) of different ages were randomly selected,
during the period started from November 2017 to May 2018 in AL-Najaf AL-Ashraf province.
Blood samples from slaughtering of animal were collected ,Five milliliter EDTA blood samples
were always used for collection of blood.Samples of blood were transferred within ice box to the
laboratory of College of Veterinary Medicine University of Baghdad and laboratory of AL-Razi
Center for research and medical diagnostic kits until for laboratory teststo conduct the necessary
tests to diagnosis ofBabesiaspp.
Slides preparation
Thick and thin blood smears were prepared according to ( 10).
DNA extraction and PCR assay:-
Oneprimer were used in this study were obtained from IDT company (Bab-spgenes). This
primers were prepared according to the information of the company (Table.1).
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
595
Primers Primer sequence (5 to 3 ) Product size
(bp)
References
Bab-sp F
GTTTCTGCCCCATCAGCTTGAC 400 (11)
R CAAGACAAAAGTCTGCTTGAAAC
Statistical Analysis
The data were subjected to analysis using SAS software (12). The McNemar's test was
used to assess the difference between the two tests and the degree of agreement between the
microscopic and PCR tests was evaluated using Kappa coefficient. The differences between
groups according to sex and age for the microscopic and PCR tests were assessed using Chisquare.
P<0.05 is considered significant.
RESULTS
Results showed that the overall incidence rate using the microscopic examination and
molecular detection method was 17.5% ,54.16% respectively figure (1).The rate of infection in
females was 10% andmales 25% by microscopic examination , while the infection rate by using
PCR in females and males was41.66%, 66.66% respectively (Table, 1).
The differences in infection rate between two tests were significant(P<0.0001) according to sex
.The agreement between the two tests according to Kappa coefficient was -0.16 which means no
agreement was found between two tests.
The differences in the infection rate between males and females were significant (P=0.03)
according to microscopic test as well as the PCR (P=0.005).
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
596
Figure (1): blood smear stained with Giemsastain(10%) show Babesia spp.with different shapes
in red blood cells of camel(arrows) (X 100).
Table1: The infection rate of Babeisaspp. in camels according to sex using microscopic
examination and PCR.
Sex No. of
blood
Sample
Microscopic
Examination
No. infected
(%)
PCR
No.
infected
(%)
McNemar's
value
P
Male 60 6(10) 25(41.66) 22.04 <0.0001
Female 60 15(25) 40(66.66)
Total 120 21(17.5) 65(54.16)
Chisquare
value
4.67 7.55
P 0.03 0.005
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
597
Table (1) show that the percentage of infection in theage group≤1 year and ≥1 year was 6.66%,
28.33% respectively by microscopical examination, while by using the molecular assay the rate
of infection in females and males was 45%, 63.33% respectively.
The differences in infection rate between two tests were significant(P<0.0001) according to
age,the agreement between the two tests according to Kappa coefficient was -0.21 which means
no agreement was found between two tests.
The differences in the infection rate between age groups were significant (P=0.001) according to
microscopic test as well as the PCR (P=0.04).
Table1: The infection rate of Babeisaspp. in camels according to age using microscopic
examination and PCR.
Age
year
No. of
blood
Sample
Microscopic
Examination
No. infected
(%)
PCR
No.
infected
(%)
McNemar's
value
P
≤1 60 4(6.66) 27(45) 20.83 <0.0001
≥1 60 17(28.33) 38(63.33)
Total 120 21(17.5) 65(54.16)
9.75 4.06
P 0.001 0.04
The resultsshowed amplification conditions were optimized for the PCR assay, using specific
primers of Bab-sp(400bp), figure (2).
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
598
Figure (2): Gel electrophoresis of PCR product of Bab-sp (4004bp), for Babesia spp.using 2%
agarose gel at 6volt /cm for 1 hour. Lane 1- 3,4,5: PCR product positive for Bab-sp genes, M:
2000-bp DNA marker.
DISCUSSION
Tick-borne diseases considered as major problems for the health camel in Iraq ,among these
diseases, camel babesiosis is the most prevalent and economically important (13). Also, the
microscopic diagnosis of babesiosis in many parts of Iraq is done by examination of blood
smears .This method is unreliable especially in subclinical infections. To determine the
epidemiology agents of babesiosis, sensitive and specific diagnostic methods, such as
polymerase chain reaction (PCR), are required to be used in Iraq, which had been developed in
order to overcome the problems faced with conventional and serological assay, In addition PCR
is a reliable method for diagnosis and epidemiological studies.
Results showed that an overall infection rate with Babesia spp. in camel as 17.5% by using
microscopic examination , these findings are similarly to previous studies that recorded an
overall prevalence of 9.98% for Babesia in South Iraq (14), 29%in Pakistan (15) ,13.2%In Saudi
Arabia (16) and 6.56% in Iran (11). This variation in the infection rate between the countries
may be due to differences in the numbers of examining the animals, survey periods climatic
factors also affect the abundance of viable parasitic. In the present study, the incidence of camel
babesiosisdiagnosis by PCR (54%) was significantly higher than diagnosed through traditional
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
599
examination of .Therefore, DNA amplification tests had higher efficiency than microscopic
examination for detection of Babesia. The results were in agreement with a previous report about
camel babesiosis(17,18).This difference is due to the high sensitivity of the polymerase chain
reaction technique compared to the conventional examination, In addition, dependent on the
experience of the microscopes (19). On the other hand the microscopic examination not reveal be
used to diagnosis the chronic cases due to low number parasite (14).This difference is due to the
high sensitivity of the polymerase chain reaction technique compared to the conventional
examination and also depends on the experience of the examination and the microscopic
examination does not reveal chronic cases .our results, the infection percentage of camel
babesiosis by microscopically and molecular methods was significantly higher in age ≥1year.
This results agreement with other studies according to the age-related immunity to
babesiosis(20,21 ). In previous observation there was no difference between Babesia spp.
prevalence in all ages and significant higher Babesia spp. (22). In general, young and adults are
susceptible to babesiosis, while in young cattle maternal antibodies persist for the longer period
of three months(23). Also,haemoglobin fetal (HbF) found in younganimalswhich is considered
one of the high resistance factors against for haempprotozoan parasites.(24).Concerning sex
susceptibility to infection, current study showed the high rate of infection of Babesiosis in
females may be due to stresses factor causes immune depression such as pregnancy and
lactation period were in agreement with(25) .We conclude from this study that the
animalreservoirs Increase the risk of spread of the disease in animalsand especially humans,
andthis drawsspecial attention. The results indicated a high efficiency of using PCR to detect
babesiosis in carrier hostscompared to using conventionalmethods.
REFERENCES
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
600
1-Preston, P.M., 2001.Theilerioses. In: Wallingford MW (ed) Encyclopediaof arthropodtransmitted
infections of man and domesticated animals. CABI, Wallingford, pp. 487–502.
2-Silva, M.G., Marques, P.X. and Oliva, A., 2010.Detection of Babesia and Theileria species
infection in cattle from Portugal using a reverse line blotting method. Vet,Parasitol., 174:199–
205.
3-Altay, K.,FatihAydin, M.,Dumanli N and Aktas, M., 2008. Molecular detection of Theileria
and Babesia infections in cattle. Vet.Parasitol., 158:295–301.
4-Wagner, G.G., Holman,P.andWaghela, S. 2002.Babesiosis and heartwater:
threats without boundaries. Vet.Clin. Food Anim., 18:417–430.
5-Martins, T.M., Pedro, O.C.,Caldeira, R.A., Do Rosário, V.E.,Neves, L. and Domingos
A.,2008. Detection of bovine babesiosis in Mozambique by a novel seminested hot-start PCR
method. Vet. Parasitol.,153: 225-230.
6-Friedhoff, K. and Bose, R., 1994.Recent developments in diagnostics of some tick-borne
diseases. In: Uilenberg, G., Permin, A., Hansen, J.W. (eds). Use of applicable biotechnological
methods for diagnosing haemoparasites. Proceedings of the Expert Consultation, Merida,
Mexico, October 4–6, 1993. Food and Agriculture Organization of the United Nations (FAO),
Rome, Italy, pp 46–57.
7-Bose, R., Jorgensen, W.K.,Dalgliesh, R.J.,Friedhoff, K.T. and De Vos, A.J., 1995.Current state
and future trends in the diagnosis of babesiosis. Vet.Parasitol., 57:61–74.
8-Altay, K.,Dumanli, N. and Aktas, M., 2007. Molecular identification, genetic
diversity and distribution of Theileria and Babesiaspecies infecting small ruminants. Vet
Parasitol. ,147:161–165.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
601
9-Mghirbi, Y.,Hurtado, A.,Brandika, J.,Khlif, K.,Ketata, Z. andBouattour, A., 2008.A molecular
survey of Theileria and Babesia parasites in cattle, with a note on the distribution of ticks in
Tunisia.Parasitol. Res., 103:435–442.
10-Chaudhry, Z.I.,Suleman ,M.,Younus , M. and Aslim ,A., 2010. Molecular etection of
Babesiain crossbred carrier camels through PCR. Pak. J. Zool., 42: 201-204.
11-Khamesipour, F,Doosti, A.,Koohi, A.,Chehelgerdi, M and Mokhtari-Farsani, A.,
2015.Determination of the presence of BabesiaDNA in blood of cattle, camel and sheep in Iran
by PCR. Arch. Biol. Sci. Belgrade., 67: 83-90.
12-SAS.,2010.SAS/STAT Users Guide for Personal Computer. Release 9.13.SAS Institute, Inc.,
Cary, N.C., USA.
13-Al-Amery,A.M.; Faraj,A.A. and Majeed,S.M.,2017.Detection of haemoprotozoa in camel in
AL-Najaf prvince , Iraq.IJABR.,7 : 238-241.
14-Jasim, H.J.; Azzal, G.Y. and Othman, M. R.,2015. Conventional and molecular detection of
Babesiacaballi and Theileriaequiparasitesin infected camels in South of Iraq. Bas.J.Vet.Res.,
14:110-121.
15-Chaudhri, S.S. and Gupta ,S.K., 2003.Manual of General Veterinary Parasitology. 1st
edition .department of Vet .Parasit.College of Vet. Sci. Haryana Agicultural University India.
Pp.46-47.
16-Swelum, A.A, Ismael, A.B,Khalaf, A.F and Abouheif, M.A. ,2014. Clinical and laboratory
findings associated with naturally occurring Babesiosis in dromedary camels. Bull.
Vet.InstPulaway., 58: 229-233.
17-Oliveira-Sequeira, T.C.G.;Oliveira, M.C.S., Araujo, J.P., 2005.PCR-based detection of
Babesiabovis and Babesiabigemina in their natural host Boophilusmicroplus and cattle. Int.J
.Parasitol.,35: 105-111.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
602
18- Esmaeilnejad, B.,Tavassoli, M.andAsri-Rezaei S., 2015.Determination of prevalence and
risk factors of infection with Babesiaovis in small ruminants from West Azerbaijan province,
Iran by polymerase chain reaction. Iran J Arthropod Borne Dis; 9: 246-252.
19-Morgan, U. M .,2000. Detection and characterisation of parasites causingemerging zoonoses .
Int. J .Parasitol., 30:1407-1421.
20-Terkawi ,M.A.,Alhasan, H. andHuyen,N.X. 2012.Molecular andserological prevalence of
Babesiabovis and Babesiabigemina in cattle from central region of Syria. Vet.Parasitol., 187:
307-311.
21-Bell-Sakyi, L.,Koney ,E.B.M. and Dogbey, O. 2004. Incidence and prevalence of tick-borne
haemoparasites in domestic ruminants in Ghana. Vet.Parasitol., 124: 25-42.
22-Terkawi, M.A.,Huyen, N.X. and Shinuo, C. 2011.Molecular and serological prevalence of
Babesiabovis and Babesiabigemina in water buffaloes in the northeast region of Thailand.
Vet.Parasitol., 178: 201-207.
23-Zintl.A.,Gray, J.S. and Skerrett, H.E. 2005. Possible mechanisms underlying age‐related
resistance to bovine babesiosis. Parasite immunol., 27: 115-120.
24-Oliveiram, M.C.,Oliveira-Sequeira, T.C.andAraujo, J.P. J. 2005. Babesiaspp. infection in
Boophilusmicroplus engorged females and eggs in Sao Paulo state, Brazil. Vet.Parasitol . 130:
61-67.
25-Sappenfield, E.Jamieson, D.J. and Kourtis, A.P. 2013. Pregnancy and susceptibility to
infectious diseases. Infect Dis Obstetrics Gynecology., 213: 1-9.

1-Preston, P.M., 2001.Theilerioses. In: Wallingford MW (ed) Encyclopediaof arthropodtransmitted
infections of man and domesticated animals. CABI, Wallingford, pp. 487–502.
2-Silva, M.G., Marques, P.X. and Oliva, A., 2010.Detection of Babesia and Theileria species
infection in cattle from Portugal using a reverse line blotting method. Vet,Parasitol., 174:199–
205.
3-Altay, K.,FatihAydin, M.,Dumanli N and Aktas, M., 2008. Molecular detection of Theileria
and Babesia infections in cattle. Vet.Parasitol., 158:295–301.
4-Wagner, G.G., Holman,P.andWaghela, S. 2002.Babesiosis and heartwater:
threats without boundaries. Vet.Clin. Food Anim., 18:417–430.
5-Martins, T.M., Pedro, O.C.,Caldeira, R.A., Do Rosário, V.E.,Neves, L. and Domingos
A.,2008. Detection of bovine babesiosis in Mozambique by a novel seminested hot-start PCR
method. Vet. Parasitol.,153: 225-230.
6-Friedhoff, K. and Bose, R., 1994.Recent developments in diagnostics of some tick-borne
diseases. In: Uilenberg, G., Permin, A., Hansen, J.W. (eds). Use of applicable biotechnological
methods for diagnosing haemoparasites. Proceedings of the Expert Consultation, Merida,
Mexico, October 4–6, 1993. Food and Agriculture Organization of the United Nations (FAO),
Rome, Italy, pp 46–57.
7-Bose, R., Jorgensen, W.K.,Dalgliesh, R.J.,Friedhoff, K.T. and De Vos, A.J., 1995.Current state
and future trends in the diagnosis of babesiosis. Vet.Parasitol., 57:61–74.
8-Altay, K.,Dumanli, N. and Aktas, M., 2007. Molecular identification, genetic
diversity and distribution of Theileria and Babesiaspecies infecting small ruminants. Vet
Parasitol. ,147:161–165.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
601
9-Mghirbi, Y.,Hurtado, A.,Brandika, J.,Khlif, K.,Ketata, Z. andBouattour, A., 2008.A molecular
survey of Theileria and Babesia parasites in cattle, with a note on the distribution of ticks in
Tunisia.Parasitol. Res., 103:435–442.
10-Chaudhry, Z.I.,Suleman ,M.,Younus , M. and Aslim ,A., 2010. Molecular etection of
Babesiain crossbred carrier camels through PCR. Pak. J. Zool., 42: 201-204.
11-Khamesipour, F,Doosti, A.,Koohi, A.,Chehelgerdi, M and Mokhtari-Farsani, A.,
2015.Determination of the presence of BabesiaDNA in blood of cattle, camel and sheep in Iran
by PCR. Arch. Biol. Sci. Belgrade., 67: 83-90.
12-SAS.,2010.SAS/STAT Users Guide for Personal Computer. Release 9.13.SAS Institute, Inc.,
Cary, N.C., USA.
13-Al-Amery,A.M.; Faraj,A.A. and Majeed,S.M.,2017.Detection of haemoprotozoa in camel in
AL-Najaf prvince , Iraq.IJABR.,7 : 238-241.
14-Jasim, H.J.; Azzal, G.Y. and Othman, M. R.,2015. Conventional and molecular detection of
Babesiacaballi and Theileriaequiparasitesin infected camels in South of Iraq. Bas.J.Vet.Res.,
14:110-121.
15-Chaudhri, S.S. and Gupta ,S.K., 2003.Manual of General Veterinary Parasitology. 1st
edition .department of Vet .Parasit.College of Vet. Sci. Haryana Agicultural University India.
Pp.46-47.
16-Swelum, A.A, Ismael, A.B,Khalaf, A.F and Abouheif, M.A. ,2014. Clinical and laboratory
findings associated with naturally occurring Babesiosis in dromedary camels. Bull.
Vet.InstPulaway., 58: 229-233.
17-Oliveira-Sequeira, T.C.G.;Oliveira, M.C.S., Araujo, J.P., 2005.PCR-based detection of
Babesiabovis and Babesiabigemina in their natural host Boophilusmicroplus and cattle. Int.J
.Parasitol.,35: 105-111.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
602
18- Esmaeilnejad, B.,Tavassoli, M.andAsri-Rezaei S., 2015.Determination of prevalence and
risk factors of infection with Babesiaovis in small ruminants from West Azerbaijan province,
Iran by polymerase chain reaction. Iran J Arthropod Borne Dis; 9: 246-252.
19-Morgan, U. M .,2000. Detection and characterisation of parasites causingemerging zoonoses .
Int. J .Parasitol., 30:1407-1421.
20-Terkawi ,M.A.,Alhasan, H. andHuyen,N.X. 2012.Molecular andserological prevalence of
Babesiabovis and Babesiabigemina in cattle from central region of Syria. Vet.Parasitol., 187:
307-311.
21-Bell-Sakyi, L.,Koney ,E.B.M. and Dogbey, O. 2004. Incidence and prevalence of tick-borne
haemoparasites in domestic ruminants in Ghana. Vet.Parasitol., 124: 25-42.
22-Terkawi, M.A.,Huyen, N.X. and Shinuo, C. 2011.Molecular and serological prevalence of
Babesiabovis and Babesiabigemina in water buffaloes in the northeast region of Thailand.
Vet.Parasitol., 178: 201-207.
23-Zintl.A.,Gray, J.S. and Skerrett, H.E. 2005. Possible mechanisms underlying age‐related
resistance to bovine babesiosis. Parasite immunol., 27: 115-120.
24-Oliveiram, M.C.,Oliveira-Sequeira, T.C.andAraujo, J.P. J. 2005. Babesiaspp. infection in
Boophilusmicroplus engorged females and eggs in Sao Paulo state, Brazil. Vet.Parasitol . 130:
61-67.
25-Sappenfield, E.Jamieson, D.J. and Kourtis, A.P. 2013. Pregnancy and susceptibility to
infectious diseases. Infect Dis Obstetrics Gynecology., 213: 1-9.

  • Receive Date 01 September 2018
  • Revise Date 30 September 2018
  • Accept Date 30 October 2018
  • Publish Date 30 November 2018