Document Type : Research Paper
Authors
Department of Veterinary Microbiology and Parasitology, College of Veterinary Medicine, University of Basrah, Iraq
Keywords
Article Title العربیة
--
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
789
MOLECULAR CHARACTERIZATION OF Parabronema skrjabini IN BASRAH
PROVINCE, IRAQ
Sajjad S. Soud, Ghazi Y. Azzal, Suzan A. Al-Azizz
Department of Veterinary Microbiology and Parasitology, College of Veterinary Medicine,
University of Basrah, Iraq
Key words: Parabronema skrjabini, Nematode, sheep.
Corresponding Author: profdrsuzan@gmail com
ABSTRACT
Parabronema skrjabini is a spirurid nematode of the family Habronematidae that
lives in the abomasum of ruminants such as sheep and goats. The purpose of this study
was to investigate the molecular aspects of Parabronema skrjabini in Basrah. The
worms were collected from slaughtered sheep and goats in Basrah slaughter house
between the period from June, 2016 to January, 2017, with total number of abomasum's
examined sheep (576) and goat ( 150 ). An internal transcribed spacer 2 ribosomal
DNA (ITS2-rDNA) fragment of P. skrjabini was amplified by polymerase chain
reaction (PCR) using a pair of specific primers (Para-Ir-R and Para-Ir-F). ITS2-rDNA
sequences by using PCR technique assay which based on a 783-bp long sequence of
the 28S rRNA gene, the total genomic DNA has been extracted by extracting kit with
some modification. ITS2 homology in different isolates was between (81–86%)
compared with the sequence data in GenBank. To our knowledge, this is the first study
in Iraq exploring the genetic diversity of Parabronema in sheep and goats.
INTRODUCTION
P. skrijabini was originally described from Russian Turkestan and is known to occur in that region
in cattle, camel, sheep and goats. The present recorders, there for the first one concerning the
occurrence of this genus in north America(1).Abomasums in zig-zag manner, their parasite mouth
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
790
is provided with pair of lateral psuedolabia. The esophagus has a short narrow anterior and a long
wide posterior part. This parasite as, revealed during the postmortem is long, slender and dark red
in color found firmly embedded in the mucous according to (2). P. skrijabini was originally
described from Russian Turkestan and is known to occur in that region in cattle, camel, sheep and
goats (1). The present recorders there for, the first one concerning the occurrence of this genus in
North America. This is a parasite of parasites is widespread in various countries in Asia, Africa, it
has been recorded in Iran (3).
In Iraq Parabronema skrijabini is widely distributed in sheep (4).P. skrijabini was recorded in first
time in goats(5).In camels infected with Parabronema skrjabini has been recorder in Iran (6) and
Iraq (7).Parabronemosis is a disease caused by the nematode P. skrijabini parasitized in
abomasums of ruminant (8).P. skrijabini are described from horned, P. skrijabini is one of the
nematodes that inhabits the abomasum of ruminants and has a wide distribution in Africa, Asia
and some Mediterranean countries. It has been reported in a number of studies from Mongolia,
Kazakhstan, Saudi Arabia, Namibia, Turkey and Iran (9).
The ITS2 sequence of Parabronema has only been examined in one study in China in which
samples were isolated from camels (10). Therefore, the present phenotypic study was conducted to
accurately identify the P. skrjabini infection in sheep and goats in Iran and to assess the level of
intraspecies variation in this parasite using the ITS2-rDNA sequences. This work is the first study
of ITS2-rDNA sequences of P. skrijabini from sheep and goats in Iraq, and its purpose was to
investigate the molecular and morphological characteristics of Parabronema species collected
from slaughtered animals (sheep and goats) in Basrah provinces.
MATERIALS AND METHODS
Samples Collection
A random visit to the Basrah slaughter house in Basrah province (twice a week) from June 2016
till January 2017 to examine abomasum of slaughtered animals (sheep and goats).The abomasum
was removed from abdominal cavity, and immediately taken to the laboratory of Parasitology,
Department of Microbiology, Veterinary Medicine College in Basrah University, for appropriate
examination
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
791
Morphological studies.
animals were brought to the laboratory of Veterinary Parasitology at the College of Veterinary
Medicine in Basrah University, and examined carefully to detecting parasites, which were isolated
from the infected abomasum. After that the worms were washed many times with normal saline
(0.9%) according to the method by (11). After being recognized, the worms were rinsed in
containers with 70% ethyl alcohol which was stored at room temperature for other tests. The
worms were mounted in phenol-alcohol on a glass slide and light pressure was applied to cause the
worm body to lie flat without being damaged. The males were studied in order to determine body
length and females to measure egg dimensions.
DNA Extraction and PCR:
The kit for genomic DNA was used ,the favor prep tissue Genomic DNA Extraction Mini Kit
(FAVORGEN / TAIWAN) animal tissue depending to the instructions of manufacturer’s and for
amplification the ITS2-rDNA gene with (783 bp) long fragment with primers. The forward primer
was Para-Ir-F(5`GTAGGTGAACCTGCGGAAGG3`)
and and reverse primer was Para-Ir-R (5`CTGAGCTGAGGTCAACGAAT- 3`) were In a
thermocycler PCR reactions were conducted under conditions The PCR was
performed using the following protocol: 5 min. incubation at 94°C to denature the double stranded
DNA, 33 cycles of 45 s at 94°C (denaturing step),45s at 59°C (annealing step), and 45 s at
72°C(extension step). Finally, the PCR was completed with an additional extension step for 5 min
at 72°C. Samples without genomic DNA were used as negative controls. The PCR products were
analyzed on 1% agarose gel (12).
DNA Sequencing
PCR product was purified for sequencing by using EZ-10 spin column DNA cleanup mini preps
Kit (Bio Basic Inc., Canada). The PCR products of the P. skrijabini and primers were sending to
Macro gen company, (USA) for sequencing. The sequence chromatograms were analyzed using
the Geneious 5.1.6 software and compared to those deposited in GenBank
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
(www.ncbi.nlm.nih.gov/) using the ‘Basic Local Alignment Search Tool’ (BLAST). All sequences
for P. skrjabini were aligned and compared with one another and with those of the ITS2
other spirurids available in GenBank TM. DNA sequences of closely related species were als
downloaded and used in the phylogenetic analysis. Multiple sequence alignments were made with
the Clustal W. Phylogenetic analyses were performed based on the Neighbor joining and
maximum parsimony methods using
Morphology:
The morphological results showed
27-34(30.5)mm long(photomicrograph
Molecular diagnosis has been done, firstly, the DNA of
Favor prep Tissue Genomic DNA Extraction Mini Kit( Favorgen Biotech
detection of genus Parabronema
presence of ITS-2 gene, the primer which was used is (
amplification of the ITS-2 fragment. Extracted DNA samples were measured by Nano
Photomicrograph (1): length of
skrijabini male.
792
) MEGA5 software.
RESULTS
male body (25-30) mm long, (photomicrograph1
4),in sheep and goat
P. skrijabini was extracted by used
/
was made by using PCR technique. In order to detect the
Para-Ir-R and Para-Ir
Photomicrograph (2): length of
skrijabini female.
P.
ITS2-rDNA of
also
photomicrograph1).Female: body
Taiwan ).the
Ir-F).whose
Nano-drop to
P.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
793
detection genus Parabronema was made by using PCR techniques. The result of PCR assay for
the amplification of the ITS-2 rDNA fragment with the designed primer set yielded destined
band corresponding to their molecular size of approximately 783bp for P.skrijabini
independently from the different host species.
Sequencing was done in this study to determine the specific strain in Iraq, PCR result product
of 28SrRNA gene of P. skrijabini were screened by sequencing of thirteen samples, The
samples view satisfactory results depending on NCBI matching. Allresults were compared with
Parabronema gene sequence and analyzed by using NCBI nucleotide blast in NCBI (http://
NCBI reference sequence) software program chromas and mega version thirteen, The
sequences were comparative with an obtainable sequence in GenBank with accession number
of (EU375510.1). ITS2-rDNA homology in different isolates was between 81% and 86%.
(Table1) presents the comparison of nucleotide sequences in the ITS2-rDNA of P. skrjabini
from the geographical regions with the referenceITS2 sequence from Gen Bank. Identification
with Iranian isolate. The all comparison of nucleotide sequences in the ITS2-rDNA of P.
skrjabini from the geographical regions with the referenceITS2 sequence from Gen Bank
Table (1): ITS-2 gene Sequences Production Significant Alignments For P. skrijabini
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
794
Fig.(1):Sequencing of P. skrijabini Isolate Genomic ITS-2 ribosomal DNA Gene as
Compared with Standard Data from Gene Bank.
The isolated genes were recorded in Gene Bank under the accession number ( LC275902 ,
LC275903 , LC275904 , LC275905 , LC275906 , LC275907 , LC275908 , LC325445.1 ,
LC325446.1, LC325447.1,LC325448.1, LC325449.1 , LC325450.1)as Iraqi strain
Phylogenetic Analysis
In the current study, the phylogenetic trees were generated depending on the compartment
between the sequences in the recent study and the sequences of the other P.skrijabini which
published in Gene Bank, phylogenetic trees were generated using MEGA software. The
phylogenetic relationship among thirteen isolates of P. skrijabini obtained during this study
and the other strains of P. skrijabini (Gene Bank) based on partial nucleotide sequence of ITS-
2 rDNA gene view as in Fig. (3) below.
Score Expect Identities Gaps Strand
414 bits (224) 5e-119 406/490 (83%) 27/490 (5%) Plus/ Plus
507 bite (274) 4e -147 496 (86%)/427 496 (5%)/29 plus/Plus
390 bite (211) 4e - 112 504 (82%)/411 504 (5%)/27 plus/Plus
442 bite (239) 2e - 127 458 (85%)/388 458 (3%)/17 plus/Plus
370 bite (200) 6e-106 451(82)/372 451 (6%)/28 plus/Plus
538 bite ( 291) 1e- 156 518 (86%)/448 518 (6%)/33 plus/Plus
486 bite (263) 5e- 141 495 (85%)/423 495 (6%)/31 plus/Plus
374 bite (202) 4e-107 497 (81%)/404 497 (6%)/31 plus/Plus
344 bite (186) 3e-98 462 (81%)/374 462 (4%)/23 plus/Plus
508 bite (275) 2e-147 497 (86%)/428 497 (5%)/29 plus/Plus
514 bite ( 278) 2e-149 506 (86%)/435 506 (5%)/29 plus/Plus
508 bite (275) 1e-147 514 (85%)/439 514 (5%)/27 plus/Plus
460 bite (249) 6e-133 495 (84%)/418 495 (5%)/29 plus/Plus
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
795
Fig.(2): Phylogenetic Relationships Based on Partial Nucleotide
Sequence of the ITS-2 rDNA Genes of P. skrijabini
DISCUSSION
In the results, ITS2 sequence identity of isolates from Iraq was between 81%
to 86% compared with the sequences in Gen bank, this agree with (10), Molecular studies
on the genus Parabronema has be chiefly based on rDNA genes obtainable in Gen bank.
Studies of ITS1 and ITS2 gene sequences of P. skrijabini in camel has shown 30.2–
60.1%similarity with other nematodes and (12) ITS2 sequence identity of different
isolates were between 68% to 77% compared with the sequences in Gen bank.
Phylogenetic tree analysis of P. skrijabini isolates and compared reference sequence from
Gen bank showed that although all of them may have a common ancestor, are grouped on
different branches; even the P. skrijabini species are distributed on several branches. The
sequences in this study were more similar to Habronema spp. There was significant
difference between the isolates in this study and sequences in Gen bank. The low ITS2-
rDNA identity in isolates from Iraq as compared to the reference sequence in GenBank
(81–86%) raise questions regarding the species identity of the parasites isolated in Iraq.
Very limited number of studies have been published on population genetics of P.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
796
skrijabini in ruminants in the world and particularly. This work is the first study of ITS-2
sequences of P. skrijabini from sheep and goats in Iraq. The results show genetic
diversity which opens fascinating avenues for future studies investigating in depth the
phylogenetic relationships of spirurid nematodes and, in particular, those existing among
species ranked within the Thelazioidea and Habronematoidea Superfamilie.
فی مدینة البصرة Parabronema skrijabini التشخیص الجزیئی لل
سجاد سالم سعود، غازی یعقوب عزال، سوزان عبد الجبار عبد العزیز
فرع الاحیاء المجھریة والطفیلیات البیطریة- کلیة الطب البیطری- جامعة البصرة
الخلاصة
التی Habronematidae تعد من الدیدان الخیطیة التی تعود العائلة Parabronema skrijabini
تعیش فی منفحة الحیوانات المجترة للاغنام والمعز. وکان الغرض من ھذه الدراسة ھو دراسة الجوانب الجزیئیة لل
محافظة البصرة / العراق .تم جمع العینات من مجزرة البصرة فی الفترة من حزیران Parabronema skrijabini
١٥٠ ) عینة منفحة من الاغنام ) ، ( (یونیو) ٢٠١٦ إلى کانون الثانی (ینایر) ٢٠١٧ وخلال ھذه الفترة تم جمع ( ٥٧٦
والمعز على التوالی .
(Parabronema skrijabin جزء من (rDNA -ITS تم تضخیم الحمض النووی الرایبوسومی ( 2
من الجینات الرنا bp على أساس طول ٧٨٣ .(Para-Ir-R and Para-Ir-F)) باستخدام زوج من االبرایمرات محددة
،S الرایبوسومی ٢٨
وقد تم استخراج الحمض النووی الجینی الکلی عن طریق الاستخلاص باستخدام الکت مع بعض
٨٦ ٪) مقارنة مع بیانات التسلسل فی بنک الجینات العالمی. - التماثل فی عزلات مختلفة بین ( ٨١ ITS التعدیل . کان 2
فی الأغنام والمعز. Parabronema تعد ھذه الدراسة ھی الاولى فی العراق استکشاف التنوع الجینی
فی عزلات مختلفة من العراق بالمقارنة مع التسلسلات المرجعیة فی بنک الجینات -ITS لوحظ ان انخفاض ھویة 2
.(٪٨٦ -٨١)
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
797
REFERENCES
1. Sarwar, M. M. (1954). On the Transference of Parabronema skrijabini Rassowska,
1924 to Squamanema Thiel, 1925 and its Occurrence in Sheep and Goats in Indo-
Pakistan. J. helminthology, 28(3-4), 143-150.
2. Eslami, A. H., & Nabavi, L. (1976). Species of gastro-intestinal nematodes of sheep
from Iran. Bulletin de la Société de Pathologie Exotique, 69(1), 92-95.
3. Al-Saeed, A. T. M., & Al-Khalidi, N. W. (1990). Epidemiological studies on
abomasal nematodes of sheep in Mosul (Iraq). J. Vet. Parasitol. 4(1), 17-20.
4. Al-Asadi, K. B. F., & Alemarah, G. Y. A. (2014). Detection of Nematode
Parabronema skrijabini In Goats at Basrah Province. J. Parasitol, 104, 194-199
5. Borji, H., Razmi, G. H., Movassaghi, A. R., Naghibi, A. G., & Maleki, M. O. H. S.
E. N. (2010). A study on gastrointestinal helminths of camels in Mashhad abattoir, Iran.
Iranian J. Vet. Research, 11(2), 174-179.
6. Al-Fatlawi, M. A. (2017). Identification of the potential vector of some Spirurida
(Parabronema skrijabini) in dromedary in Iraq. Kufa J. Vet. Me. Sci., 7(1B).
7. Kaufmaun J. Parasites infection of domastic animals. Diagnostic manual. (1996). Pp:
423.
8. Hasheminasab, S. S. (2015). Molecular characterization of the first internal
transcribed spacer of rDNA of Parabronema skrijabini for the first time in sheep. Ann
Parasitol, 61(4), 241-6.
9. Zhang, X. D., Yang, X. Y., Yang, L. R., LI, L. C., Zuo, H. T., NA, R. H., ... &
Wang, J. J. (2009). Cloning and Sequence Analysis of the rDNA-ITS of Parabronema
skrijabini. Chin. J.Anim. and Vet. Sci.:5
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
798
10. Farhan, H. S., Morphological and Molecular Study of Fasciola gigantica In
Buffaloes and Cows. M.Sc. thesis, Coll. Vet. Med., Univ. Basrah.(2016).
11. Hasheminasab, S. S., Jalousian, F., & Meshgi, B. (2016). Molecular and
morphological characterization of Parabronema skrijabini of sheep and goats at three
different geographical zones in Iran. Ann. Parasitol , 62(1).
| Article View | 370 |
| PDF Download | 234 |