EVALUATION OF ANTIBACTERIAL OF ZINC OXIDE NANOPARTICLES, ALOE VERA GEL AGAINST MRSA SKIN INJURY

Document Type : Research Paper

Authors

1 Department of Biology /College of Science / University of Baghdad

2 Department of Pathology, College of Veterinary Medicine, University of Baghdad

Abstract
Microbial resistance to antibiotics increase the risk of infection, so new approach was
investigated such as new plant extracts and nano technology, so this study designed to compare
the effects of Zinc oxide nanoparticles and Aloe Vera extraction in treatment of experimental
skin infection with MRSA. In vitro, both were effective against MRSA in well diffusions assay,
while in vivo, both were showed antibacterial effects and enhance tissue healing compared with
MRSA infective group with priority to Aloe Vera extraction

Keywords

Crossmark

Article Title العربیة

--

Abstract العربیة

--

Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
203
EVALUATION OF ANTIBACTERIAL OF ZINC OXIDE
NANOPARTICLES, ALOE VERA GEL AGAINST MRSA SKIN INJURY
Mais E. Ahmed* , Ahmed Q Al-Awadi**
*Department of Biology /College of Science / University of Baghdad.
**Department of Pathology, College of Veterinary Medicine, University of Baghdad.
Corresponding author: mais.e.mahmood@gmail.com
Key words: MRSA, Aloe Vera gel, ZnO NPs.
ABSTRACT
Microbial resistance to antibiotics increase the risk of infection, so new approach was
investigated such as new plant extracts and nano technology, so this study designed to compare
the effects of Zinc oxide nanoparticles and Aloe Vera extraction in treatment of experimental
skin infection with MRSA. In vitro, both were effective against MRSA in well diffusions assay,
while in vivo, both were showed antibacterial effects and enhance tissue healing compared with
MRSA infective group with priority to Aloe Vera extraction.
INTRODUCTION
The most complex and harmful physical injuriesto clinically evaluate and manage.In
addition topain and distress, a large burned area will leave the patient with visible physical scars
and invisible psychological sequelae(1).Infectious diseases, whether they are intracellular or
extracellular, have always been a global problem to public health, causing millions of deaths
each year ,Bacterial resistance to antibiotics has become a global problem nowadays,
(2)nanomaterials, such as metal oxide nanoparticles, have appeared to be promising candidates
during the last few years. As a result, the science of nanotechnology has significantly advanced
due to its wide application (3) Nanoparticles (NPs) are used in many commercial products and
new applications in biomedicine, yet their fate, potential toxicity, and mechanisms of
translocation in biological cells, (4)
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
204
To reduce pain and accelerate the healing process, many natural substances have been
traditionally used and more recently have been scientifically studied, such as Aloe (5) Aloe vera
has been used in a host of curative purposes including treatment of skin disorders and healing of
wounds. The colorless gel that comes from the leaf parenchyma has been used to treat burns
because, besides being a potent moisturizing agent, it helps in the healing process of skin lesions
and alleviates pain (6)
Methicillin-resistant Staphylococcus aureus (MRSA) is the most pathogen bacterial
causing important infections from skin and soft tissue infections such as pneumonia,
endocarditis, bacteremia and sepsis (7, 8). It is nonpoisonous; it can accelerate wound healing,
reduce blood cholesterol levels, stimulate the immune response and can be biologically
decomposed. It has a stronger antimicrobial property compared to chitin in avoiding fungi
because it has an active group that will bind to microbes, so it can inhibit microbial growth. (9,
10)
MATERIAL AND METHODS
Thirty swaps were collected from medical implants from (AlYarmouk Teaching
Hospital/Baghdad/Iraq), cultured on mannitol salt agar and incubated at 37Cº for 24 hours. The
colonie's morphology, Gram stain and Biochemical characteristics ,For inoculum standard, there
were homogenized MRSA cells in solution saline (NaCl 0.85 %) and the suspending was diluted
to 0.5× 108 CFU∙mL−1 using a O.D (11)
Antibiotic Sensitivity Test:
Standard homogenized S.aureus was prepared in normal saline and the suspending was
diluted to 0.5× 108 CFU ml compared with McFarland tubes Antibiotic sensitivity test for
S.aureus was done by Kirby-Bauer disk diffusion method against Amoxicillin , Cloxocillin ,
Ampicillin , Cefetrexon and tetracycline .The zone of inhibition were measured (mm) and
compared with pretive chart a documented standard, the zone of inhibition (in mm) Clinical and
Laboratory Standards Institute (12).
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
205
DNA extraction
Genomic DNA was extracted from the detected bacterial isolates according to the
protocol of Wizard Genomic DNA Purification Kit, Promega. Quantus Florometer was used to
detect the concentration of extracted DNA
Primers Selection
The set of primers 27F (AGAGTTTGATCTTGGCTCAG) and
1492R(TACGGTTACCTTGTTACGACTT) was used for amplification of 16s rRNA for
identification of bacteria at gene level (13)
Preparation of Zinc Oxide Nanoparticles (ZnO NPs):
The used preparation procedure was described by (14) but with the insert of
modifications. Zinc acetate dehydrate and Sodium hydroxide were purchased. ZnO NPs were
synthesized by precipitation method using zinc acetate dehydrate (as a source of zinc) and
sodium hydroxide used as precursors and deionized water that used to dilution. 0.1 mole of zinc
acetate dihydrate Zn(CH3CO2)2.
2H2Owas taken and dissolved in 100 ml of deionized water with stirring using a magnetic
bar stirrer for the purpose of completely dissolving zinc acetate dehydrate, forming transparent
solution. After making sure that the zinc acetate dehydrate are completely dissolved, added
sodium hydroxide NaOH gradually with stirring at different quantities for the purpose of
changing the pH value of the material to be prepared (using PH meter to measure the pH
required), here is a white solution formed. Left it on the magnetic stirrer for 30 minutes at 75 °C,
then removed the solution from stirrer. The solution washed and filtered five times with
deionized water with a process called Washing and Filtering, the white precipitate is formed. and
then dried in the electrical furnace at 100 ° C, the white precipitate separated into a part at
calcined at 500 ° C for 3 hours, and part of without calcined. The resulting material was grinding
by a mortar to obtain final product (ZnO nano in powder shape), as shown in fig (1).
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
206
Figure. 1: ZnO nanoparticles
Characterization techniques:
Chitosan/Zinc NPs synthesized were characterized by:
 UV-vis Spectroscopy (Shimadzu, UV-1601PC).
 X-Ray Diffraction (XRD) (Shimadzu, XRD-6000).
 Transmittion Electron Microscopy (TEM) (Philips, CM10).
 Atomic force microscope (AFM) (Angstrom Advanced Inc. , AA2000, Contact mode).
Preparation of A. vera Gel:
The plant of (leaves) A. vera was harvested from a (Iraq-Baghdad). Than washed with
sterile distilled water to remove dirt and their thick epidermidis was then dissected longitudinally
into pieces. The colorless parenchymatous tissue was collected in a sterile container. One
hundred grams of the gel was mixed in one liter of 2% dimethyl sulfoxide and kept at 4∘ C.
showed fig (2)
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
207
Figure(2 ) Aloe gel
Laboratory animals
Thirty albino male Swiss white mice (17-25) g at 10 weeks age, obtained from Al-Nahrian
University. The animals were maintained at a temperature of 25 °C, and had excess free to food
pellets and water throughout the experimental work.
Mouse wound infection Wound distance:
In order to produce skin injury, the mice were anesthetized with and ( IP )injection of both of
xylazine (5 mg/kg) and ketamine (75 mg/kg). Then the hair on the flank .The cleaned by soap
and sterile D.W before shaved area than drying skin wound was induced using lancet sterile in
which line of superficial
Experimental design
Mice were divided into five major groups (each group 5 mice) as the follows:
 Group1:(n=6) negative control group
 Group2: (n=6) mice were subjected to superficial skin wound without any treatment
(wound only) and considered as positive control group.
 Group 3: (n=6) mice were subjected to superficial skin wound and infected with MRSA
(0.1 ml of 0.5× 108 CFU ml)
 Group 4 (n=6) mice were wounded and infected with MRSA then treated with Zinc
Oxide NPs
 Group 5:(n=6) mice were wounded and infected with MRSA then treated with A. Vera
Gel.
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
208
RESULT AND DISCUSSION
Isolation and Identification S. aureus:
Fifty specimens were collected over a period of a month between August and December
2019.While the isolates on Blood agar showed color yellow-gray colonies are (4-3) mm in
diameter on the zones of β-hemolysis.This description is mentioned by (Figure 3)
Figure (3): S.aureus: (A) On mannitol salt agar (B) Blood agar
S.aureus C) Milk agar at 37°C for 24 hrs. Figure (4) show various levels susceptibilities
to different antibiotics among isolates that were observed by Disk diffusion method. The isolates
of S. aureus (n=22) showed different susceptibility towards 5 antimicrobial agents used, there
were about 14(%) resist to Azithromycin, 12(%) resist to cefoxitin, 6(%) resist to Gentamicin
and 16(%) resist to Trimethoprim . There was less resistance to Levofloxacin 4(%) than other
antibiotics, all the results of AST .isolates was multi-resistance for antibiotics with a high level
against, Gentamicin, Azithromycin, Cefoxitin , Trimethoprim and Levofloxacin result was
similar to that acquired by (15)
A B
B
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding o
Veterinary Medicine. University of Basrah. Iraq
Figure (
Confirmation of S. aureus,a using
Molecular diagnosis of S.aureus
were confirmed by AST and Vitek 2 system gave positive results for multiplex P
reaction (PCR).showed figure(
Figure (5) : Agarose gel (1%) electrophoresis (100v/mAmp for 90min) of amplified
(1500pb) from bacterial DNA stained with ethidium bromide. Lane M. 100 bp DNA ladder, Lane
1. Unknown bacterial isolates
0
10
20
30
40
50
60
70
80
90
1
percentag Resistance
of the 17th International
Iraq.
209
4): Antibiotic susceptibility test of S.aureus
Vitek 2 System organism with probability (98
aureus:The results shwen that multiplex PCR analysis for both strain
5)
2 3 4 5
A ntibiotic Levofloxacin
Conference. College of
98-99) %
Polymerase chain
16s rRNA
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding o
Veterinary Medicine. University of Basrah. Iraq
Study of Zinc NPs Nanoparticles characterization:
Spectral Properties of the Zn NPs
placed around 340 nm. This indicates
since it does not comprise any aromatic amino acids, the 215 nm was
Figure(6)
Atomic Force Electron Microscopy (AFM)
The AFM micrograph acquired
alterations and the surface roughness change [root mean square (Rp)] values were
For the sample the roughness value was
value was 20 nm.
Figure(7
0
2
4
6
8
10
12
٣٢٠ ٣٤٠
of the 17th International
Iraq.
210
Nanoparticles: Figure ( 6 ) revealed a strong surface plasmon
. the creation of Zn NPs. It is not likely
selection
)Absorption spectra of Zinc NPs nanoparticles.
for the Zinc NPs Figure (7 ) shows
٤٢ nm and the section analysis of the sample’s grain size
7): AFM for Chitosan/Zinc NPs nanoparticles
٣٦٠ ٣٨٠ ٤٠٠ ٤٢٠ ٤٤٠ ٤٦٠ ٥٠٠
Conference. College of
to detect at 280 nm
the surface roughness
recognized.
٥٤٠
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
211
Transmission Electron Microscope (TEM Analysis):
(TEM) imaging, the Zn NPs suspensions according (15).
Figure(8): TEM for ZnO NPs
Antibacterial Activity :
About antibacterial activities of A. vera gel showed MDR strains except five of them were
inhibited by A.vera gel extractat.
Zn NPs and Aloe vera Gel Assay
The well diffusion agar method (WDA) was used to detection S. aureus to word Zn NPs
at concentration 128 μg\ ml and Aloe vera Gel. The result was recorded below in Table (1) The
inhibition zone size reached ( 11 and ) mm recpectively while (16) proved the activity of ZnO
NPs with acetic acid on Staph. aureus in mutton meat.
Table(1): Inhibition zone well diffusion agar method.
Inhibition zone (mm) ZnNPs at conc( 128 μg\ ml) Aloe vera Gel
15 ± 1.06 7 ± 0.33
LSD value
*Each value is the mean of three replicate (mean ± SE) values with difference letter have
significant different * (P<0.05) .
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
212
Histopathology: Skin section from negative control group showed normal architecture (Figure
9)
Figure (9): Histological section from negative control group showed normal skin histology
(H&E stain; 200×)
In the first group –positive control group (wound only), at 7 day post injury the skin
showed incomplete regeneration of the epithelial cells of the epidermis which extended under the
necrotic debris, while the dermis showed mild infiltration of MNCs (Figure 10) .
Figure 10: Histopathological section (positive control group), 7 days post injury showed
incomplete regeneration of the epidermal epithelia (arrow) under the necrotic tissue and
proliferation of MNCs in the dermis (H&E stain; 200×)
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
213
The Histopathological changes in the third group (infected group) characterized by
present of necrotic tissue in the injured site with neutrophils infiltration extended to the dermal
layer (Figure 11).
Figure 11: Histopathological section (infected group), 7 days post injury showed necrotic
tissue (arrow) in the injured site with neutrophils infiltration extended to the dermal
layer (H&E stain; 200×)
The histopathological section in the 4th group (treated with ZnONPs) showed incomplete
regeneration of the epithelial layer under the necrotic tissue (Figure 12) and mild infiltration of
inflammatory cells mainly neutrophils and MNCs in the dermal layer.
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
214
Figure 12: Histopathological section (ZnONPs group), 7 days post injury showed incomplete
regeneration of the epithelial layer under the necrotic tissue (H&E stain; 200×)
In the 5th group (treated with Aloe Vera Gel), 7 day post injury the skin showed complete
regeneration of the dermal epithelia and infiltration of inflammatory cells mainly neutrophils in
the dermis and hypodermis (Figure 13).
Figure 13: Histopathological section in skin (Aloe Vera group), 7 days post injury showed
complete regeneration of the dermal epithelia and infiltration of inflammatory cells mainly
neutrophils in the dermis and hypodermis (H&E stain; 200×).
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
215
In the third group (infected with MRSA), the severe tissue damage and failure of skin
healing can be attributed to the pathogenicity of MRSA which characterized by its resistance and
the ability to evade the immune system in addition to their important such as (toxins, enzymes,
adhesion proteins, and others ) (17) for example that S. aureus strain express PVL protein caused
necrotizing and the current result may same idea to explain the acute necrosis in the skin, also the
infiltration of neutrophils in epidermis and subcutaneous tissue, also an effective immune
response against S. aureus in and during the first 24 hr, neutrophils recruitment to the site of
infection is required for skin wounds of mice inoculated with MRSA developed neutrophilic
abscesses (18). The 5th group which treated with nanoparticles showed a good healing and this
may contributed to the antibacterial properties of the ZNO since nano-sized ZnO is safe and does
not irritate skin (19)
REFERENCES
1.S.E.Wolf,J.P.Sterling,J.L.Hunt,andB.D.Arnoldo,“Theyearinburns2010,”Burns,vol.37,no.8,p
p.1275–1287,2011
2.Moravej H, Moravej Z, Yazdanparast M, et al. Antimicrobial peptides: features, action, and
their resistance mechanisms in bacteria. Microb Drug Resist. 2018;24(6):747-767
3.Suresh S, Karthikeyan S, Saravanan P, Jayamoorthy K. Comparison of antibacterial and
antifungal activities of 5-amino-2mercaptobenzimidazole and functionalized NiO
nanoparticles. Karbala International Journal of Modern Science. 2016;2(3):188195
4.Xia T, Li N, Nel AE. Potential health impact of nanoparticles. Annu Rev Public Health
2009;30:137–150
5.T. Reynolds and A. C. Dweck, “Aloe vera leaf gel: a review
update,”JournalofEthnopharmacology,vol.68,no.1–3,pp.3–37, 1999.
6.L. Cuttle, M. Kempf, O. Kravchuk et al., “The efficacy ofAloe vera, tea tree oil and saliva as
first aid treatment for partial thickness burn injuries,” Burns, vol. 34, no. 8, pp. 1176–
1182, 2008
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
216
7.Gould IM, David MZ, Esposito S, Garau J, Lina G, Mazzei T, et al. New insights into
meticillinresistant Staphylococcus aureus (MRSA) pathogenesis, treatment and
resistance. Int J Antimicrob Agents. 2012;39(2):96-104
8.Fischbach MA, Walsh CT. Antibiotics for emerging pathogens. Science.
2009;325(5944):1089-93
9.Kishen A, Shi Z, Shrestha A, Neoh KG. An investigation on the antibacterial and antibiofilm
efficacy of cationic nanoparticulates for root canal disinfection. J Endod.
2008;34(12):1515-20
10.A. K. Azad, N. Sermsintham, S. Chandrkrachang and W. F. Stevens, J. Biomed. Mater. Res.,
Part B, 2004, 69, 216–222
11.Namasivayam S K R, Preethi M, Bharani A R S, Robin G, and Latha B. Biofilm
Inhibitory Effect of Silver Nanoparticles Coated Catheter against Staphylococcus aureus
and Evaluation of Its Synergistic Effects with Antibiotics. International Journal of
Biological & Pharmaceutical Research, 3; 2012: 259-265
12.Cotter P.D.; Ross R.P.andHill C. (2013). Bacteriocins—aviable alternative to
antibiotics? Nat. Rev. Microbiol. 11:95–105.
13.Srinivasan,R.; Karaoz,U.; Volegova,M., MacKichan,J.; Kato-Maeda, M.; Miller, S.;
Nadarajan,R.; Brodie,E. and Lynch, S. Use of 16S rRNA Gene for Identification of a
Broad Range of Clinically Relevant Bacterial Pathogens. PLoS One.; (2015). 10(2):
e0117617
14.Koutu, V., Shastri, L., and Malik, M. M. (2016). Effect of NaOH concentration on optical
properties of zinc oxide nanoparticles. Materials Science-Poland, 34(4), 819-827
15.Mais Emad.Ahmed and Sana MH AL-Shimmary(2018) Comparative study between Pure
Bacterocin and Vancomycin on Biofilms of MRSA isolated from medical implants. /J.
Pharm. Sci. & Res. Vol. 10(6), 2018, 1476-1480
16.Mirhosseini, M. and Arjmand V. (2014): Reducing Pathogens by Using Zinc Oxide
Nanoparticles and Acetic Acid in Sheep Meat. J. of Food Protection,77 (9):15991604
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
217
17.Chipolombwe, J., Török, M.E., Mbelle, N., Nyasulu, P. (2016) Methicillin-resistant
Staphylococcus aureus multiple sites surveillance: a systemic review of the literature.
Infection and drug resistance. 9:35-49.
18.Mölne, L., Verdrengh, M., Tarkowski, A. (2000) Role of neutrophil leukocytes in
cutaneous infection caused by Staphylococcus aureus Infection and immunity, 68(11):
6162-7.
18.Vinardell, M. P., Llanas, H., Marics, L., & Mitjans, M. (2017). In vitro comparative skin
irritation induced by nano and non-nano zinc oxide. Nanomaterials, 7(3), 56

1.S.E.Wolf,J.P.Sterling,J.L.Hunt,andB.D.Arnoldo,“Theyearinburns2010,”Burns,vol.37,no.8,p
p.1275–1287,2011
2.Moravej H, Moravej Z, Yazdanparast M, et al. Antimicrobial peptides: features, action, and
their resistance mechanisms in bacteria. Microb Drug Resist. 2018;24(6):747-767
3.Suresh S, Karthikeyan S, Saravanan P, Jayamoorthy K. Comparison of antibacterial and
antifungal activities of 5-amino-2mercaptobenzimidazole and functionalized NiO
nanoparticles. Karbala International Journal of Modern Science. 2016;2(3):188195
4.Xia T, Li N, Nel AE. Potential health impact of nanoparticles. Annu Rev Public Health
2009;30:137–150
5.T. Reynolds and A. C. Dweck, “Aloe vera leaf gel: a review
update,”JournalofEthnopharmacology,vol.68,no.1–3,pp.3–37, 1999.
6.L. Cuttle, M. Kempf, O. Kravchuk et al., “The efficacy ofAloe vera, tea tree oil and saliva as
first aid treatment for partial thickness burn injuries,” Burns, vol. 34, no. 8, pp. 1176–
1182, 2008
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
216
7.Gould IM, David MZ, Esposito S, Garau J, Lina G, Mazzei T, et al. New insights into
meticillinresistant Staphylococcus aureus (MRSA) pathogenesis, treatment and
resistance. Int J Antimicrob Agents. 2012;39(2):96-104
8.Fischbach MA, Walsh CT. Antibiotics for emerging pathogens. Science.
2009;325(5944):1089-93
9.Kishen A, Shi Z, Shrestha A, Neoh KG. An investigation on the antibacterial and antibiofilm
efficacy of cationic nanoparticulates for root canal disinfection. J Endod.
2008;34(12):1515-20
10.A. K. Azad, N. Sermsintham, S. Chandrkrachang and W. F. Stevens, J. Biomed. Mater. Res.,
Part B, 2004, 69, 216–222
11.Namasivayam S K R, Preethi M, Bharani A R S, Robin G, and Latha B. Biofilm
Inhibitory Effect of Silver Nanoparticles Coated Catheter against Staphylococcus aureus
and Evaluation of Its Synergistic Effects with Antibiotics. International Journal of
Biological & Pharmaceutical Research, 3; 2012: 259-265
12.Cotter P.D.; Ross R.P.andHill C. (2013). Bacteriocins—aviable alternative to
antibiotics? Nat. Rev. Microbiol. 11:95–105.
13.Srinivasan,R.; Karaoz,U.; Volegova,M., MacKichan,J.; Kato-Maeda, M.; Miller, S.;
Nadarajan,R.; Brodie,E. and Lynch, S. Use of 16S rRNA Gene for Identification of a
Broad Range of Clinically Relevant Bacterial Pathogens. PLoS One.; (2015). 10(2):
e0117617
14.Koutu, V., Shastri, L., and Malik, M. M. (2016). Effect of NaOH concentration on optical
properties of zinc oxide nanoparticles. Materials Science-Poland, 34(4), 819-827
15.Mais Emad.Ahmed and Sana MH AL-Shimmary(2018) Comparative study between Pure
Bacterocin and Vancomycin on Biofilms of MRSA isolated from medical implants. /J.
Pharm. Sci. & Res. Vol. 10(6), 2018, 1476-1480
16.Mirhosseini, M. and Arjmand V. (2014): Reducing Pathogens by Using Zinc Oxide
Nanoparticles and Acetic Acid in Sheep Meat. J. of Food Protection,77 (9):15991604
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
217
17.Chipolombwe, J., Török, M.E., Mbelle, N., Nyasulu, P. (2016) Methicillin-resistant
Staphylococcus aureus multiple sites surveillance: a systemic review of the literature.
Infection and drug resistance. 9:35-49.
18.Mölne, L., Verdrengh, M., Tarkowski, A. (2000) Role of neutrophil leukocytes in
cutaneous infection caused by Staphylococcus aureus Infection and immunity, 68(11):
6162-7.
18.Vinardell, M. P., Llanas, H., Marics, L., & Mitjans, M. (2017). In vitro comparative skin
irritation induced by nano and non-nano zinc oxide. Nanomaterials, 7(3), 56

  • Receive Date 01 September 2020
  • Revise Date 30 September 2020
  • Accept Date 30 October 2020
  • Publish Date 01 November 2020