Document Type : Research Paper
Authors
1 Department of Microbiology, Faculty of Veterinary Medicine,University of Kufa,Kufa,Iraq
2 Department of Pathology, Faculty of Veterinary Medicine,University of Kufa,kufa,Iraq
Keywords
Article Title العربیة
--
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
262
DIFFERENTIAL EXPRESSION OF SECRETED ASPARTYL PROTEASE
(SAP8 AND SAP10) GENES AND COMPARATIVE PATHOGENICITY OF
Candida albicans GROWN IN VARIOUS ENVIRONMENTAL
CONDITIONS
Inas K. Rahem*,Hayder M. Samaka* , Hutheyfa A. Al Salih**
*Department of Microbiology, Faculty of Veterinary Medicine,University of Kufa,Kufa,Iraq.
**Department of Pathology, Faculty of Veterinary Medicine,University of Kufa,kufa,Iraq
Corresponding Author: enase503@gmail.com
Keywords: Candida albicans, SAP8 gene, SAP10 gene.
ABSTRACT
This study focusing on the importance of Candida albicans growth conditions on SAP8
and SAP10 genes expression, as a member of the Secreted Aspartic Proteases superfamily genes
that play a role in the pathogenicity of C. albicans and the effects of this conditions on the
pathogenicity of this bacterium in albino mice.Ten pathogenic isolates of C. albicans were
grown on two different conditions using RPMI1640 medium at 37° C for mimic host condition
and on Sabouraud Dextrose Agar (SDA) at 25° C as in vitro condition. Sets of primers were used
to detect SAP8 and SAP10 genes expression in each condition. Forty BALB/c albino mice were
assigned to groups and inoculated with 1 X 107 cells/mouse of C. albicans grown in the study
conditions as challenge dose. Kidneys, lungs, and liver were collected to study the pathological
changes. Data show overexpression of the SAP8 gene in study isolates grown in RPMI1640
comparison to the SAP10 gene. Kidneys, liver, and lungs showed pathological lesions at a
different range of severity, a significant severe lesion in the kidney in mice injected with C.
albicans grown in RPMI 1640 medium, while in contrast the significant severe liver and lung
lesions were observed in mice injected with C. albicans grown in SDA medium. This study
points out that the growth condition of C. albicans plays a role in the pathogenicity of this
microorganism and SAP8 gene related to the infection process in the host.
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
263
INTRODUCTION
Candida albicans is polymorphic fungus considered as a member of the normal microflora in
human and animals and exist as a lifelong, harmless microbiome in varied hosts, but in some
conditions, related to the host or environment, C. albicans can become a serious pathogen,
leading to a variety of infections range from superficial infections of the skin to fatal systemic
infections (1, 2).
The ability of C. albicans to cause infections is supported by a group of factors and
attributes which considered as virulence factors, including the morphological transition between
yeast and hyphal forms (phenotypic switching), adhesions and invasions, biofilms formation, and
secretion of hydrolytic enzymes (3-6).
Secreted aspartyl proteinases, phospholipase B, and lipases are the most important
exoenzymes produced from C. albicans and play an important role in the pathogenicity of this
microorganism (7), Secreted aspartyl proteinases (SAPs) are enzymes encoded by a group of
superfamily genes (SAP1 to SAP10), most of them has a defined role and action in the
pathogenicity of C. albicans in adhesion, invasion and tissue destruction (6 - 8), but still, the full
functional repertoire of the Sap genes family has yet to be revealed(7).
(9) revealed a correlation between SAP8 expression and biofilm formation. Also, in
pathogenic fungi, mitogen activated protein kinase (MAPK) pathways regulate dimorphism,
biofilm/mat formation, and virulence. The reduction in SAP8 expression inhibit MAPK activity
led to fail in biofilm formation (10).
While SAP10 have a roles in cell surface integrity and adhesion (11-14), while Candida
albicans showed a variation in its abilities to adhesion and biofilm formation, when cultured in
different growth conditions (15).
The present study was conducted to investigate the levels of SAP8 and SAP10 genes
expression in Candida albicans that grown in two different conditions, RPMI1640 (to mimicking
host conditions in vitro) and Sabouraud dextrose agar (SAD) as laboratory conditions, also to
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
264
investigate the pathological features of Candida albicans that grown in these two conditions in
albino mice.
MATERIAL AND METHODS
Secreted Aspartyl Proteinase 8 and 10 gene expression analysis
Ten pathogenic isolates of Candida albicans, obtained from clinical cases in previous
study [16], were included in this study, the isolates were cultivated on Sabouraud dextrose agar
(SDA) nightlong at 25oC and then 0.5 ml of stocks suspension (OD600=0.1) from each isolates
were cultivated on two different conditions: laboratory conditions (on SDA at 25°C) and host
conditions (on RPMI1640 at 37°C), after 12 hours; all isolates were harvested and prepared for
RNA extracted using YeaStar RNA Kit from (ZYMO Research, USA).
Set of primers from (17,18) were used for analyze SAP8 and SAP10 gene expression using
ACT1 gene as internal control (Table 1). The relative change of SAP 8 and SAP10 gene
expression was done by comparing the genes expression levels on the RPMI1640 medium as a
target to the genes expressions on SDA medium as a calibrator using (ACT1) gene as a reference
gene (19), data analyzed by MxPro qPCR software from (Agilent, USA).
The following protocol was used in the real-time PCR system (MX 3005P system, Agilent,
USA) using One step EvaGreen qRT-PCR kit (Applied Biological Materials Inc., USA): one
cycle on 42°C for 15 min., 95°C for 10min. for initial denaturation and 40 cycles as follow: 95°C
for 15 sec. , 60°C for 60sec., then melting curve cycle as instrument instruction (50-95°C).
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
265
Table 1: Primers set used in real-time PCR for the quantification of the expression
of C. albicans SAP 8 and SAP 10 genes.
Experimental infections
To investigate the pathogenicity of C. albicans in vivo, all experimental animals were
inoculated by study isolates grown on two different study conditions at dose of 1X107
cells/mouse intravenously (tail vein) to induce sub-acute systemic infection (20). Forty BALB/c
albino mice (bodyweight range 20 to 30 gm) were assigned to five groups (eight mice each
group) namely, G1, G2, G3 and G4, in addition to GC group as control group mice were
received one injection of normal saline at day one of the experimental period. Group G1 and G2
mice were inoculated with C. albicans isolates grown in (RPMI1640) at day one of experimental
period and group G3 and G4 mice were inoculated with isolates grown in (on SDA medium) at
day one of experimental period. Mice were euthanized after 30 days of experimental period by
exsanguination under general anesthesia, the National Institutes of Health guide for the care and
use of Laboratory animals (NIH Publications No. 8023, revised 1978) and Institutional Animal
Ethics Committee (IAEC) instructions in the university of Kufa have been followed in the
handling of the laboratory animals.
Primer Primer sequence Reference
ACT1
R 5'-ATGGGATGAATCATCAAACAAGAG-3'
(18)
F
5'-
TTTCATCTTCTGTATCAGAGGAACTTATT
T-3'
SAP8
R 5'-GGTGTTCCCATCAAGATCATAAACT-3'
(19)
F
5'-GGTGTTAGTAGAGATCTGGCCACTATT-
3'
SAP 10
R 5'-CCGTCCTTTTCAGTCTTGAGATC-3'
F 5'-GGTTTTCGATAGGCGATTGAGA-3'
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
266
Lesion scoring system
Lesion scoring system was conducted to observe the significance of pathological changes
in experimental animals. The lesion scoring system criteria were written down according to
observation, monitoring, and assessment the lesion in kidney, lung and liver samples of the
whole present study (Table 2). The analysis data obtained, systematic lesions score was designed
under the supervision of group of Pathologist in the Faculty of Veterinary Medicine-University
of Kufa.Lesion scoring system was divided into four grades normal, mild, moderate and severe
with values 0, 1, 2, 3 and 4, respectively. The histopathological lesion scoring results were
analyzed statistically using Kruskal Wallis non-parametric one-way ANOVA test while using
Mann Whitney U test to compare between the groups.
Table 2: Lesion score criteria of lungs, kidneys and liver in the experimental
animals, the lesions score was designed under the supervision of group of
Pathologist in the Faculty of Veterinary Medicine-University of Kufa.
Lung
Lesion Lesion score description
severity
Lesion
score
0 Normal Normal lung histology
1-Hyperplasia of alveolar walls in the focal area in pulmonary parenchyma,
2-Congestion,
3-Small focal areas of infiltrated inflammatory cells.
1 Mild
1-Severe congestion of all blood vessels lumen,
2-Observation of moderate hemorrhage in pulmonary parenchyma,
3-Presences of small masses of inflammatory cells and some necrotic debris of
pneumocytes,
4-The alveolar walls of certain areas in the lung were thickened due to hyperplasia of
pneumocytes.
2 Moderate
1-Severe massive hyperplasia of alveoli leads total close of alveolar spaces forming
compact tissue feature in contrast to normal lung histology of spongy tissue feature led
to the loss of normal pulmonary architecture,
2-Infiltration of inflammatory cells within the hyperplastic cells and also in large masses
mixed with necrotic tissue debris,
3-Severe massive hemorrhage in all lung parenchyma.
3 Sever
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
267
Kidney:
Lesion
score
Lesion
severity Lesion score description
0 Normal Normal kidney histology
1 Mild
1. Congestion of renal blood vessels,
2. Infiltration of inflammatory cells aggregated in small areas in kidney cortex,
3. Mild necrosis in renal tubules with the presence of pyknosis in epithelial cells of
tubules.
2 Moderate
1. Aggregation of inflammatory cells mixed with necrotic debris of renal epithelial
cells of proximal and distal convoluted tubules in the cortex or in the loop of
Henle tubules in medulla forming a masses parenchyma of kidney,
2. Absence of renal tubules structure of cortex due to necrosis of epithelial cells in
focal areas,
3. Severe congestion almost in all renal blood vessels.
4. Hemorrhage also observed in the renal parenchyma,
5. Congestion of glomerulus of capillaries loop.
3
Sever
1. Massive necrosis of epithelial cells of proximal and distal convoluted tubules with
the presence of inflammatory cells within necrotic tissue led to loss of normal
cortex architecture,
2. Necrosis of loop of Henley tubules led, absence of tubules structure in the
medulla,
3. Aggregation of inflammatory cells mixed with the debris of necrotic tissue
forming a large masses in cortex or medulla of the kidney,
4. Presence of fungus colonies in the medulla area mixed with inflammatory cells
(especially neutrophil) in medulla was observed in certain cases,
5. Presence of pus feature lesion of the mixture of inflammatory cells and necrotic
tissue forming a large mass in the medulla,
6. Massive hemorrhage observed in all kidney parenchyma due to destruction of
blood vessels.
7. Some glomerulus appeared hyperplastic with an absence of capillaries loop
forming a consolidated cellular mass inside bowman capsule,
8. In certain cases, severe lesion showed cyst feature lesion manifested by the
formation of huge cysts lined by very thin cells with the presence of the lesions,
which described above.
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
268
Liver:
Lesion
score
Lesion
severity Lesion score description
0 Normal Normal liver histology
1 Mild
1. Infiltration of inflammatory cells in limited numbers aggregated near portal areas,
2. Congestion of blood vessels of portal areas,
3. Mild necrosis signs observed presented by hepatocytes pyknosis.
2 Moderate
1. Necrosis of hepatocytes was observed near portal area with the presence of fatty
liver changes in certain liver lobules,
2. Aggregation of inflammatory cells in clusters within liver parenchyma and some
of these clusters contain necrotic tissue debris.
3. Hemorrhage observed in the area surrounded the portal areas (not in centric to
lobules),
4. Congestion also observed in most hepatic blood vessels.
3 Sever
1. Massive necrosis of hepatocytes with severe fatty liver changes were observed in
all lobules of liver sample and this change manifested by presence of triglyceride
molecules forming a large vacuole in the cytoplasm, even larger than the original
cells size in some affected cells,
2. Disappearance of hepatocytes chain structure with the absence of hepatic sinusoid
due to the massive necrosis of hepatocytes either sinusoid endothelial cells,
3. Massive hemorrhage was spread in all liver parenchyma due to destruction of
central veins, endothelial sinusoid cells necrosis or portal area blood vessels,
4. Presence of inflammatory in all affected areas of liver parenchyma within the
necrotic tissues or aggregated as clusters,
5. Loss of normal liver architecture
RESULTS
Sap8 and SAP10 gene expression analysis:
This study showing that the SAP8 and SAP10 gene expression levels were different in
different Candida albicans isolates, and SAP8 gene expression levels were significantly higher
than SAP10 gene expression in C. albicans that grown in PRMI1640 medium compared with C.
albicans grown in Sabouraud dextrose agar, while study isolates showed non-significant
differences between SAP8 and SAP10 gene expression in C. albicans that cultured in RPMI1640
medium (Figure 1).(Table 3)
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
269
Figure 1: qRT-PCR fold change of SAP8 gene and SAP10 gene in Candia albicans
isolates growing in RPMI 1640 medium comparing to Candia albicans isolates
growing in SAD medium.
Table 3: Relative expression of (SAP8 and SAP10) genes in Candida albicans
isolates grown in RPMI1640 medium compared to the SDA medium as a reference.
Gene expression T test P value
(in SAD medium as
control)
Gene expression
(in RPMI 1640 medium
as target)
Type of gene
means± SE means± SE
Sap 8 3.748±1.68a 0±0b 2.325 0.047*
Sap 10 -0.316±0.38 a 0±0 a 0.831 0.428**
* Significant difference (P <0.05), ** No significant difference (P >0.05)
Histopathology
Kidneys, Liver and lungs samples of mice treated with Candida albicans showed a
pathological lesion at a different range of severity compared with control mice.In the kidney, the
lesion was observed at a range of severity from normal to severe grade, however severe lesion
was observed in 50% of groups G1 and G2 mice (Table 4).
Table 4: Lesion severity distribution of kidney of groups G1, G2, G3 and G4 mice.
Group Lesion grade Total
Normal Mild Moderate Severe mice no.
G1 1 (12.5%) 1 (12.5%) 2 (25%) 4 (50%) 8
G2 Nil 3 (37.5%) 1 (12.5%) 4 (50%) 8
G3 4 (50%) 3 (37.5%) 1 (12.5%) nil 8
G4 4 (50%) 4 (50%) nil nil 8
-10
-5
0
5
10
15
20
10 9 8 7 6 5 4 3 2 1
SAP 10
SAP8
Fold change
isolates
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding o
Veterinary Medicine. University of Basrah. Iraq
The lesion of kidney was characterized by total
cortex and medulla areas, also cystic lesion was manifested in cyst lined by one layer of cuboidal
epithelial cells with empty spaces was observed (
Figure 2 : Photomicrographs of kidney. A/ Normal histology o
lesion of kidney. Mild grade lesion was characterized by presence of hemorrhage
(yellow arrows) within renal tubules of cortex and medulla and destruction of limited
numbers of loop of Henley tubules (black arrows) in kidney medulla
Moderate grade lesion of kidney. The moderate grade lesion was manifested in
destruction of renal tubules in cortex area with inflammatory cells that infiltrated in
affected area, note absence the most of proximal or distal convoluted tub
that surrounding the glomerulus (yellow arrow) with presence of renal tubules
individuals (black arrows) in affected area led to loose of kidney architecture in affected
area, also few numbers of cystic lesion of kidney (red arrows) was observ
hemorrhage was observed in affected area. D/ Severe grade lesion. The severe grade
lesion was characterized by total absence of renal tubules features that replaced by large
clusters (yellow arrows) of inflammatory cells formed with presence of s
lesion (red arrows) within this clusters in cortex area led to loose of kidney normal
architecture completely. H&E. A, B, C and D: 100x.
The fungus was colonized in medulla areas with presence of inflammatory cells within the fungi
colonies, however fungi colonies were observed in groups G1 and G2 mice and did not observe
in groups G3 and G4 mice (Fig. 3).
of the 17th International
Iraq.
270
he absence of renal tubules features of
Fig 2).
of kidney. B/ Mild grade
ig. f Conference. College of
f was observed. C/
tubules feature
observed. Also,
severe cystic
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding o
Veterinary Medicine. University of Basrah. Iraq
Figure 3 : Photomicrographs of kidney. A/ The severe grade lesion was characterized by
presence of cyst features (yellow arrows) extended
inflammatory cells. Note the total absence of all renal tubules structure, where the
glomerulus (red arrows) were surrounded with renal cysts. B/ Renal cysts lesion was
vary in size with empty spaces, and this cysts were lin
epithelial cells (yellow arrows). C&D/
kidney. Note the Candida albicans
cells (yellow arrows), and closed to loop of Henley tubules (re
B, C and D: 400x.
In the liver, the lesion was observed at
significantly severe lesion was observed in 87.5% of group G4 mice.
of the 17th International
Iraq.
271
over all cortex, surrounded by
lined by one layer of cuboidal
Candida albicans colonized in medulla area of
hyphae (black arrows) mixed with inflammatory
red arrows). H&E. A: 100x,
a range of severity from normal to severe grade (
f Conference. College of
ed d Table 5),
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding o
Veterinary Medicine. University of Basrah. Iraq
Table 5: Lesion severity distribution of
Group Normal
G1 3 (37.5%)
G2 4 (50%)
G3 1 (12.5%)
G4 nil
The lesion of liver was characterized by diffuse
parenchyma with severe necrosis of hepatocytes forming
liver normal architecture (Fig 4&5).
Figure 4: Photomicrographs of liver. A/ Normal histology of liver. B/ Mild grade lesion of
liver. The mild grade lesion was manifested in presence of hemorrhage (black arrows) in
liver parenchyma, also psychosis or Karyorrhexis of hepatocytes were observed
Moderate grade lesion of liver. Moderate grade lesion was characterized by fatty
degeneration (black arrows) of hepatocytes forming a vacuoles in liver parenchyma with
presence of inflammatory cells (yellow arrows) aggregated focally near blood vess
of the 17th International
Iraq.
272
liver of groups G1, G2, G3 and G4 mice.
Lesion grade
Mild Moderate Severe
1 (12.5%) 3 (37.5%) 1 (12.5%)
3 (37.5%) 1 (12.5%) nil
3 (37.5%) 4 (50%) nil
nil 1 (12.5%) 7 (87.5%)
severe fatty liver degeneration in all liver
spaces in parenchyma led to loose of
ig f Conference. College of
Total
mice no.
8
8
8
8
observed. C&D/
vessels with
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding o
Veterinary Medicine. University of Basrah. Iraq
limit number of these cells were spread in hepatic sinusoid. H&E. A, B and C: 100x, D:
400x.
Figure 5 : Photomicrographs of liver. A, B, C&D/ Severe grade lesion of liver. Severe
grade lesion was characterized by observation of severe fatty liv
liver parenchyma with severe necrosis of hepatocytes forming a spaces (black arrows)
in parenchyma led to loose of liver normal architecture, note the individuals of
hepatocytes between the necrosis spaces (Arrow heads). Inflammatory
arrows) spread in the spaces of necrotic hepatocytes and near blood vessels of the
affected areas. Also, giant cells (red arrow) was observed in affected area with presence
of congestion in blood vessels. H&E. A&B: 100x, C&D: 400x
In the lungs, the lesion was observed at range of severity from normal to severe grade (
6). However, normal lung histology did not observed in groups G3 and G4 mice and lesion was
between mild to moderate grades.
of the 17th International
Iraq.
273
liver degeneration in all
f Conference. College of
er cells (yellow
Table
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding o
Veterinary Medicine. University of Basrah. Iraq
Table 6: Lesion severity distribution of
Group
Normal
G1 6 (75%)
G2 1 (12.5%)
G3 nil
G4 nil
The lesion of lung was characterized by
diffuse infiltration of inflammatory cells led to
parenchyma and losing the norma
Figure 6: Photomicrographs of lungs. A/ Normal histology of lung. B&C/ Mild grade
lesion of lung. The mild grade lesion was characterized by mild thickness of alveolar
walls (black arrows) due to congestion of alveolar capillaries (yellow arrows),
of the 17th International
Iraq.
274
lungs of groups G1, G2, G3 and G4 mice.
Lesion grade
Mild Moderate Severe
1 (12.5%) 1 (12.5%) nil
6 (75%) nil 1 (12.5%)
4 (50%) 4 (50%) nil
5 (62.5%) 3 (37.5%) nil
massive hyperplasia of pneumocytes
nflammatory total absent of alveolar features of lung
normal lung architecture completely (Fig 6&7).
f Conference. College of
Total mice
no.
8
8
8
8
with
l
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding o
Veterinary Medicine. University of Basrah. Iraq
hyperplasia of pneumocytes and infiltration of inflammatory cells (red arrows). Blood
vessels congestion was also observed. D/ Moderate grade lesion of lungs. Moderate
grade lesion was characterized by severe hemorrhage in lung parenchyma with
congestion (black arrows) of
capillaries congestion (yellow arrows), hyperplasia of pneumocytes and infiltration of
inflammatory cells (red arrows) was observed. The thickening of alveolar walls led to
narrowing the alveolar spaces, which filled transudate fluid (arrow heads). H&E. A, B,
C &D: 100x.
Figure 7: Photomicrographs of lungs. A,B&
grade lesion was characterized by massive hyperplasia of pneumocytes with diffuse
infiltration of inflammatory cells (yellow arrows) led to lose normal lung architecture
completely. Inflammatory cells aggregated foca
Moderate grade lesion of lungs. Moderate grade lesion was characterized by severe
hemorrhage in lung parenchyma with congestion of blood vessels. Thickening of
alveolar walls due to alveolar capillaries congestion (yellow
pneumocytes and infiltration of inflammatory cells (red arrows) was observed. The
of the 17th International
Iraq.
275
eumocytes blood vessels. Thickening of alveolar walls due to alveolar
C/ Severe grade lesion of lungs. Severe
focally or extended in parenchyma. D/
arrows), hyperplasia of
f Conference. College of
lly
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
276
thickening of alveolar walls led to narrowing the alveolar spaces, which filled
transudate fluid (arrow heads). H&E. A, B &D: 100x, C: 400x
The statistical analysis of lesion scoring results revealed a significant (p<0.5) severe lesion
of kidney in group G1 compared with groups G3 and G4, and in group G2 compared with groups
G3 and G4. Also, a significant (p<0.5) severe lesion of the liver was observed in group G4
compared with other Candida albicans challenged groups. The significant (p<0.5) severe lesion
of the lung was observed in groups G3 and G4 compared with group G1 (Table 7).
Table 7: Statistical analysis of lesion scoring of groups G1, G2, G3 and G4 mice.
Group
Lesion scoring mean rank
Kidney Liver Lung
G1 21.50a 16.00 10.92
G2 23.25a 11.33 17.25
G3 12.75 16.33 21.75c
G4 11.75 26.42b 20.17c
* The letter a in superscript indicates the significant differences (p<0.05) in groups G1 and G2 compared with
groups G3 and G4. The letter b in superscript indicates the significant differences (p<0.05) in group G4 compared
with groups G1, G2, and G3. The letter c in superscript indicates the significant differences (p<0.05) in groups G3
and G4 compared with group G1.
* n= 8 mice each group
DISCUSSION
A combination of environmental and genetic factors that affect the characteristics of C.
albicans and effect on the pathogenicity of this bacterium as a result (6, 21, 22, 23). C. albicans
showed a variation in adhesion and biofilm formation abilities when cultured in different media.
Previous researches documented that adhesion and biofilm abilities decreased in C. albicans
cultured in Sabouraud dextrose agar compared with C. albicans cultured RPMI1640 (15).
Candida albicans secreted aspartyl protease as a part of virulence factors in the
pathogenicity process this enzyme causes a disruption in host cells to promote invading in or
between epithelial cells in the target tissue (24). SAP 8 reflected as a secretory protein to the
surrounded medium of the microorganism and play a role mainly in the extensive tissue
penetration, while SAP 10 classified as binding structural protein (cell surface protein)
(8,11,17,25,26).
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
277
This study showed a difference in the expression level of SAP8 genes in different study
isolates while the total SAP8 gene expressed more than SAP10 significantly in the RPMI 1640
medium, this agrees with findings of Staniszewska and his colleagues when they test the effects
of serum on SAP8 and SAP10 expression (24) and also agrees with (27) who mentioned that the
Sap8 overexpressed in the late phase of infection and disagree with other studies which indicate
that the level of Sap8 expression in oral infection is decreased while Sap10 gene expression is
unchanged in hyphal mutant strain (7, 27).The structural of SAP10 protein with C-terminal
sequences (glycol- phosphotidylinositol (GPI)–anchored proteins), make it unable to be secreted
from Candida cells and it has an important role as a part of C. albicans cell wall structural protein
(7).
Intravenous administration of C. albicans can induce multi-organs infection leading to
damage of these organs. Kidney is a preferred site in C. albicans systemic infection and theses
infection may lead to severe damage in kidney parenchyma. According to lesion scoring results,
significant severe lesion of kidney was observed in mice injected with C. albicans grown in
PRMI1640 medium compared with mice injected with C. albicans grown in SDA. Also, fungi
colonies were observed in mice that injected with C. albicans grown in PRMI1640 medium and
did not observe in other groups.
However, lesion scoring results showed a significant lesion in liver of mice injected with
C. albicans grown in laboratory condition and significant severe lesion in lung of mice injected
with same fungi, in contrast to results of mice injected with C. albicans grown in host condition
where the significant severe lesion observed in kidneys. According to histopathology results, C.
albicans grown in laboratory condition showed a different path of pathogenicity by targeting the
liver and lung in comparing with C. albicans grown in host condition, where the severe lesion
was observed in kidney.
REFERENCES
1- Conti HR, Huppler AR, Whibley N, Gaffen SL.( 2014). Animal Models for Candidiasis.
CurrProtocImmunol.;105:19.6.1–19.6.17.
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
278
2-Tsui C, Kong EF, Jabra-Rizk MA.(2016) Pathogenesis of Candida albicans biofilm. Pathog
Dis.; 74(4):ftw018. https://doi:10.1093/femspd/ftw018.
3- Finkel JS, Mitchell AP. Genetic control of Candida albicans biofilm development. Nat Rev
Microbiol. 2011; 9(2):109-18.
4-Tournu H, Van Dijck P. Candida Biofilms and the Host: Models and New Concepts for
Eradication. Int J Microbiol. 2012; 2012:845352.
5- Mathé L, Van Dijck P. Recent insights into Candida albicans biofilm resistance. Curr Genet.
2013; 59(4):251-64.
6- Mayer FL, Wilson D, Hube B. Candida albicans pathogenicity mechanisms. Virulence,
2013; 4(2):119-28.
7- Naglik JR, Challacombe SJ, Hube B. Candida albicans secreted aspartyl proteinases in
virulence and pathogenesis. Microbiol Mol Biol Rev. 2003; 67(3): 400-28.
8-De Bernardis F, Sullivan PA, Cassone A. Aspartyl Proteinases of Candida albicans and
Their Role in Pathogenicity. Medical Mycology, 2001.
9- Ramage G, Rajendran R, Sherry L, Williams C. Fungal biofilm resistance. Int J Microbiol.
2012;2012:528521.
10-Puri S, Kumar R, Chadha S, Tati S, Conti HR, Hube B, Cullen PJ, Edgerton M.
Secreted Aspartic Protease Cleavage of Candida albicans Msb2 Activates Cek1
MAPK Signaling Affecting Biofilm Formation and Oropharyngeal Candidiasis. PLoS
One, 2012; 7(11).
11- Albrecht A, Felk A, Pichova I, Naglik JR, Schaller M, de Groot P, Maccallum D, Odds
FC, Schäfer W, Klis F, Monod M, Hube B. Glycosylphosphatidylinositol-Anchored
Proteases of Candida albicans Target Proteins Necessary for Both Cellular Processes
and Host-Pathogen Interactions. J Biol Chem. 2006; 281(2):688–94.
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
279
12-Hogues H, Lavoie H, Sellam A, Mangos M, Roemer T, Purisima E, Nantel A, Whiteway
M. Transcription factor substitution during the evolution of fungal ribosome
regulation. Mol Cell. 2008; 29(5):552-62.
13-Aoki W, Kitahara N, Miura N, Morisaka H, Yamamoto Y, Kuroda K, Ueda M.
Comprehensive characterization of secreted aspartic proteases encoded by a virulence
gene family in Candida albicans. J Biochem. 2011;150(4):431-38.
14- Nobile CJ, Fox EP, Nett JE, Sorrells TR, Mitrovich QM, Hernday AD, Tuch BB, Andes
DR, Johnson AD. A recently evolved transcriptional network controls biofilm
development in Candida albicans. Cell. 2012; 148:126-38.
15-Weerasekera MM, Wijesinghe GK, Jayarathna TA, Gunasekara CP, Fernando N,
Kottegoda N, Samaranayake LP. Culture media profoundly affect Candida albicans
and Candida tropicalis growth, adhesion and biofilm development. Mem Inst Oswaldo
Cruz. 2016; 111(11): 697–702.
16-Samaka HM, Al-Mohana AM, Al-Hamadani AH, Al-Charrakh AH. Genotyping and
Antifungal Susceptibility Profile of Candida albicans Isolated from Cancer Patients.
JCPS. 2018; 11(3):236–41.
17-Samaranayake YH, Cheung BP, Yau JY, Yeung SK, Samaranayake LP. Human Serum
Promotes Candida albicans Biofilm Growth and Virulence Gene Expression on
Silicone Biomaterial, PLoS One, 2013; 8(5).
18-Del Aguila EM, Dutra MB, Silva JT, Paschoalin VM. Comparing protocols for preparation
of DNA-free total yeast RNA suitable for RT-PCR., BMC Mol Biol. 2005; 6,9:
e62902.
19-Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR,
Nucleic Acids Res. 2001; 29(9):e45. https://doi:10.1093/nar/29.9.e45.
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference. College of
Veterinary Medicine. University of Basrah. Iraq.
280
20-Molero G, Díez-Orejas R, Navarro-García F, Monteoliva L, Pla J, Gil C, Sánchez-Pérez
M, Nombela C. Candida albicans: Genetics, Dimorphism and Pathogenicity. Int
Microbiol. 1998; 1(2):95-106.
21-Sudbery PE. Growth of Candida albicans hyphae. Nat Rev Microbiol. 2011; 9(10):737-48.
22-Jacobsen ID, Wilson D, Wächtler B, Brunke S, Julian R, Hube B, Brunke S, Naglik JR
Hube B. Target Candida albicans dimorphism as a therapeutic target. Expert Rev Anti
Infect Ther. 2012;10(1):85-93.
23-da Silva Dantas A, Lee KK, Raziunaite I, Schaefer K, Wagener J, Yadav B, Gow NA.
Cell Biology of Candida albicans–Host Interactions. Curr Opin Microbiol.
2016;34:111–18.
24- Staniszewska M, Bondaryk M, Malewski T and Kurzatkowski W. Quantitative
Expression of Candida albicans Aspartyl Proteinase Genes SAP7, SAP8, SAP9,
SAP10 in Human Serum in Vitro. Pol J Microbiol. 2014; 63(1):15-20.
25-Ahmad Khan MS, Ahmad I, Aqil F, Owais M, Shahid M and Musarrat J (2010).
Virulence and Pathogenicity of Fungal Pathogens with Special Reference to Candida
albicans. In "Combating Fungal Infections: Problems and Remedy" (pp. 21–45).
Springer Berlin Heidelberg.
26-Schild L, Heyken A, de Groot PW, Hiller E, Mock M, de Koster C, Horn U, Rupp S,
Hube B. Proteolytic Cleavage of Covalently Linked Cell Wall Proteins by Candida
albicans Sap9 and Sap10. Eukaryot Cell. 2011; 10(1):98–109.
27-Naglik JR, Moyes D, Makwana J, Kanzaria P, Tsichlaki E, Weindl G, Tappuni AR,
Rodgers CA, Woodman AJ, Challacombe SJ, Schaller M, Hube B. Quantitative
Expression of the Candida albicans Secreted Aspartyl Proteinase Gene Family in
Human Oral and Vaginal Candidiasis. Microbiology. 2008; 154(11):3266–80.
| Article View | 410 |
| PDF Download | 295 |