Document Type : Research Paper
Authors
1 Institute of Genetic Engineering & Biotechnology for Postgraduate Studies, University of Baghdad, Baghdad, Iraq.
2 Institute of Genetic Engineering & Biotechnology for Postgraduate Studies, University of Baghdad, Baghdad, Iraq
Keywords
Article Title العربیة
Authors العربیة
شملت هذه الدراسة ثلاث اجزاء: عزل جرثومة Enterotoxigenic B.fragilis من 94 عینة براز تم جمعها من مستشفیات مختلفة فی مدینة بغداد من بدایة آذار / 2020 حتى نهایة نیسان / 2021. تم زرع عینات البراز على وسط BBE فی حالة لاهوائیة لمدة 24-48 ساعة. تم التعرف على بکتیریا B.fragilis بناءً على الخصائص المورفولوجیة على وسائط BBE: مستعمرات دائریة صغیرة محدبة باللون الرمادی تحیط بالمنطقة السوداء حول المستعمرات والطرق الجزیئیة باستخدام جینات محددة 16S rRNA , bft. اظهرت النتائج34عزلة B.fragilis کانت موجبة لجین 16S rRNA و 5 B.fragilisموجبة لجین bft صنفت على أنها سموم معویة (ETBF). تم تنقیة العزلة ETBF التی کانت موجبةللجینات bft و 16S rRNAباستخدام طریقة Van Tassel .تم تقسیم ثلاثین ذکرمن الفئران إلى ثلاث مجموعات مع 10 فئران لکل مجموعة المجموعة الأولى کمجموعة سیطرة .المجموعة الثانیة عبارة عن فئران تحکم إیجابیة یتم تناولها یومیًا 2٪ کبریتات دیکستران الصودیوم ، فئران المجموعة الثالثة تم إعطاؤها بواسطة أنبوب معدی 2٪ DSS لمدة 10 أیام بعد 10 أیام الفئران تم إعطاؤها 20 میکروغرامًا من الذیفان bft عن طریق أنبوب المعدةلمدة 30 یوم. فی نهایة التجربة ، قُتلت جمیع مجموعات الفئران بأخلاق القتل الرحیم. تمت إزالة عینات الأنسجة (الکبد والأمعاء والطحال) من الفئران. تم تثبیت الأعضاء فی 10٪ فورمالین مخزون محاید للتقنیات النسیجیة.التغیرات النسیجیة المرضیة فی المجموعة الثالثة فی الکبد فی الفئران أظهرت: خلایا کبدیة نخریة وأشباه جیوب متوسعة مصحوبة بنزیف.کما أظهرت التغیرات النسیجیة المرضیة فی الجزء المعوی من الفئران: تقشر وتآکل الزغابات وتقصیر الزغابات. أظهرت التغیرات النسیجیة المرضیةفی الطحال : تسلل أمیلوید (الداء النشوانی) وجمیع البصیلات اللمفاویة مستنفدة مع الخلایا اللیمفاویة النخریة.
Keywords العربیة
|
Proceeding of 8th International Scientific Conference, College of Veterinary Medicine University of Basrah, Dec. 7-8, 2022,Iraq.
Basrah Journal of Veterinary Research, 2022, 21(S1):1-13
|
Research Article |
|
|
|
Experimental study on the effect of bft toxin isolated and purified from clinical isolates of Enterotoxigenic Bacteroides fragilis on the liver, spleen and intestine of mice
Hussein Ali Khaleefah, Ashwak Basim Jasim
Institute of Genetic Engineering & Biotechnology for Postgraduate Studies, University of Baghdad, Baghdad, Iraq.
Corresponding Author Email Address: Ashwakbio2006@yahoo.com
ORCID ID: 0000-0001-9256-234X
DOI:
Accepted: Nov. 2022
Abstract
This study includes three parts: isolation of Enterotoxigenic Bacteroid fragilis from 94 stool samples collected from different hospitals in Baghdad city from the beginning of March/2020 to the end of April/2021. Stool samples were streaked on BBE media in an anaerobic condition for 24-48h. Identification of Fragilis was done based on morphological characteristics on BBE media: gray convex small rounded colonies surround black zone colonies and molecular method using specific genes 16S rRNA and bft gene. Results showed 34 Fragilis isolates were positive for the 16S rRNA gene and 5 Fragilis positive for the bft gene were classified as Enterotoxigenic Fragilis (ETBF). ETBF isolate which was positive for the bft gene and 16S rRNA was purified by using the Van Tassel method. 30 male mice were divided into three groups with 10 mice for each group the first group as control, the second group is positive control mice administered daily2% dextran sulfate sodium for 30 days, the third group mice administered by stomach tube 2%DSS for 10 days after 10 days mice administered with 20 µg of bft toxin by stomach tube for 30 days. At the end of the experiment, all groups of mice were killed by euthanized ethics. Tissue samples (liver, intestine, and spleen) from mice were removed. The organs were fixed in 10% neutral buffered formalin for histological techniques. Histopathological changes in the third group, in the liver section of a mouse inoculated with DSS+bft toxin, showed: necrotic hepatocytes and dilated sinusoids with hemorrhage. Histopathological changes in the intestine section of a mouse inoculated with DSS+bft toxin showed: sloughing and degenerated villi and shorten villi. Histopathological changes in the spleen section of a mouse inoculated with DSS+bft toxin showed: amyloid infiltration and all lymphoid follicles depleted with necrotic lymphocytes.
Key words: Bacteroides fragilis, bft toxin, liver.
Introduction
Enterotoxigenic Bacteroides fragilis (ETBF) is a human colonic commensal associated with juvenile diarrhea as well as high-grade colorectal cancer (1, 2)
B. fragilis toxin (BFT) which is referred to as fragilysin is commonly expressed by enterotoxigenic B. fragilis (ETBF) (3,4). BFT is a heat-labile zinc-dependent metalloprotease with a molecular mass of 21 kDa. BFT produces proenzymes with a molecular mass of 44.4 kDa that contains an N-terminal pro-domain, a C-terminal catalytic domain, and a flexible linker (5). Three isoforms of BFT have been demonstrated including BFT1, BFT2, and BFT3 of which isoform BFT1 is the most common (6,7). BFT is a biologically active molecule and different activities have been described for it, including morphological effects on intestinal epithelial cells, induction of chloride release, and elevated permeability of human gut mucosa and epithelial cell monolayers (8). Signaling pathways affected by the toxin cause differential gene expression and epigenetic changes in HT29 cells (9). In animal models, BFT is sufficient and necessary to induce colitis in both mice and gerbils (10, 11). BFT also triggers ROS generation, DNA cleavage, and cell proliferation due to the induction of the cellular inhibitor of apoptosis protein-2 (c-IAP2) and spermine oxidase (SMO) (12,13). The induction of pro-carcinogenic signaling by BFT due to NF-κB activation in the response to Th17 has been reported which induces myeloid-cell-mediated colon carcinogenesis (14).
This study aimed to investigate the effectiveness of bft toxin on the liver, intestine, and spleen of mice.
Materials and Methods
Collection of samples: A total number of 94 stool samples included :(50 for diarrheal and 44 for healthy control) were collected from different hospitals in Baghdad city from the beginning of March/2020 to the end of April/2021.
Isolation and Identification of B.fragilis from stool sampleA small portion from 94 : stool samples was taken by using a sterile swab suspended in thioglycollate broth (TB) as transport media and were streaked on Bacteroides Bile Esculin Agar Base (BBE) and incubated for 24-48 hours at 37 ºC under anaerobic conditions. The pure the bacterial culture was further diagnosed based on morphological characteristics, biochemical test, and 16S rRNA gene for conformation of B.fragilis isolates and bft gene for identification of Enterotoxigenic B.fragilis from Non-ETB using specific primers Table (1). Genomic was isolated from bacterial growth according to the protocol of QIAamp DNA Mini Kit. Qauntas fluorometer was used to detect the concentration of extracted DNA. DNA bands were detected by using the Agarose gel electrophoresis technique (1.5% agarose).
Purification of bft toxin from ETBF isolates:
1- All isolates of ETBF which contain the gene of bft depending on PCR technique were used. In the preparation of culture supernatant which was recovered by centrifugation at 2000mg for 40min at 4ºC. Determination of protein concentration was done by (17).
2- Purification steps of metalloproteases toxin bft were carried out according to the Van Tassel method (18).
3- Dextran sulfate sodium: 40kDa was purchased from sigma: prepared by dissolving 20 gm in 1liter of D.W.
Experimental study on mice
1-Animal grouping: Thirty (n = 30) juvenile albino male mice, Mus musculus BALB /C strain aged (3-5) weeks and weighing (20-25) g. Animals were housed in plastic cages 30 x 10 x 10 c.m³ placed in the room for two weeks for adaptation. Standard rodent diet (Commercial feed pellets) and drinking water were given regularly. Housing conditions were maintained at 22± 4°C, and the air of the room was changed continuously by using ventilating vacuum and light/dark cycle (14/10) h/day. The litter of cages were changed every seven days.
The experiments of this study were conducted in the animal house of the AL-Nahrain research center /AL-Nahrain University. /Baghdad/ Iraq.
Mice were divided randomly and equally into 3 groups each group contains 10 mice:
First group (control group): mice given drinking water for 30 days. Second group (positive control): mice were given daily with drinking water freshly prepared 2% Dextran sulfate sodium by stomach tube for 30 days. Third group: mice administered by stomach tube 2% DSS for 10 days, in the 10 day after that mice were administered by stomach tube with 20µg bft toxin by stomach tube (19) for 30 days.
2-Histopathological study
At the end of the experiment, all groups of mice were killed by euthanized ethics. Tissue samples (liver, intestine, and spleen) from mice were removed. The organs were fixed in 10% neutral buffered formalin and processed for paraffin embedding. The histopathological sections 5 μm were stained with hematoxylin-eosin, with the following procedure as mentioned by (20).
Table (1): sequence of primers used for conventional PCR
|
Target gene |
Primer Sequence |
Amplicon size (bp) |
References |
|
|
16S rRNA
|
F |
TCRGGAAGAAAGCTTGCT |
162 |
(15) |
|
R |
CATCCTTTACCGGAATCCT |
|||
|
bft |
F |
GACGGTATGTGATTTGTCTGAGAGA |
294
|
(16) |
|
R |
ATCCCTAAGATTTTATCCCAAGTA |
|||
Table (2): PCR cycling program for amplifying 16S r RNA and bft genes
|
NO |
steps |
Temperature (ºC) |
Time |
Number of cycles |
|
1 |
Initial denaturation |
95 |
5 min |
1 |
|
2 |
Denaturation |
95 |
30sec |
30 |
|
3 |
Annealing |
a-56 b-52
|
30sec 30sec
|
|
|
4 |
Extension |
72 |
30sec |
|
|
5 |
Final extension |
72 |
7min |
1 |
a= Annealing temperature for 16S rRNA gene, b Annealing temperature for bft gene.
Result
1-isolation and identification of B.fragilis bacteria from stool samples:
From 94 stool samples, A total of 34 suspected B.fragilis bacteria were isolated from the BBE agar depending on the morphological characteristics of the colonies, they were gray convex small rounded colonies surrounding black zone colonies due to esculin hydrolysis .B.fragilis produced esculetin and dextrose by esculin hydrolysis. further diagnosis depending on biochemical tests recorded that all 34 isolates were B.fragilis.Conventional PCR techniques were used for further conformational diagnosis of all (34) isolates of B.fragilis bacteria depending on specific primers for the 16S rRNA gene, which are specific for diagnosis. All isolates gave positive results and the amplified fragments(162bp) were separated by electrophoresis stained with ethidium bromide and photographed using a gel imaging system Fig(1). Furthermore the investigation showed the presence of bft gene 5(14.7%) from 34 B.fragilis that indicated by 16S rRNA gene.
Histopathological Examination:This work focused on the effect of purified bft toxin from ETBF on some organ sections (liver, intestine, and spleen) of mice stained with HE.The results of the control group showed normal architecture of the liver, intestine, and spleen, Figures (3-5) respectively. While the result of the second group ( positive control group) / mice received only 2% dextran sulfate sodium for 30 days revealed histopathological changes in the liver section included: congested central vein, all hepatocytes degenerated, vacuolated hepatocytes, and narrow sinusoids Fig. (6). The histolopathogical changes in the intestine section: increase mucin of goblet cells in villi, congestion, and hemorrhage in submucosa and oedema in submucosa Fig. (7). Histopathological changes in the spleen section in Fig. (8) appear with extensive red pulp hemorrhage, most lymphocyte pyknotic and depleted lymphoid follicles. Besides the histopathological in the third group demonstrated necrotic hepatocytes and dilated sinusoids with hemorrhage in the liver Fig (9).In addition to sloughing and degeneration of villi, shorten villi in the intestine and amyloid infiltration and all lymphoid follicles depleted with necrotic lymphocytes in the spleen, Figs. (10,11) respectively.
Figure (1): Gel electrophoresis of amplified 16S rRNA housekeeping gene (162bp) using conventional PCR. Agarose 1.5 %, 100 V for 60 minutes stained with ethidium bromide dye and visualized on a UV transilluminator. Lane M: 100 bp DNA ladder.lanes: 66,67,71,72,74,75,76,77,79 show negative results and lanes 64,65,68,69,70,,73,78,80,81,82. Show positive results.
Figure (2) :Gel electrophoresis of amplified bft gene (294bp). Agarose 1.5 %, 100 V/cm for 60 minutes, stained with ethidium bromide dye and visualized on a UV transilluminator. Lane M: 100 bp DNA ladder.All Lanes show positive result: Amplicons bft gene for ETBF.
|
Figure (4): Normal intestine section of control mouse showed: a) Mucosa ) submucosa layer (H&E stain X20)
|
|
Figure (3): Normal section of liver of control mouse showed: a: Central vein b: hepatocytes c: sinusoids (H&E stain X20)
|
|
Figure (6) :Histopthological changes in liver section of positive group of mice showed :a)congested central vein b)all hepatocytes degeneratedc) vacuolated hepatocytes d)narrow sinusoids (H&E stain, 40x).
|
|
figure (5): Normal spleen section of control mouse showed: a) normal lymphocytic follicle (H&E stain X20)
|
|
Figure(8):Histopathological changes in spleen section of mouse inoculated with DSS showed :a)extensive red pulp hemorrhage b)most lymphocyte pyknotic and depleted lymphoid follicles(H&E stain, 20X).
|
|
Figure(7):Histopathological changes in intestine section of mouse inoculated with DSS showed :a)increase mucin of goblet cells in villi b)congestion and hemorrhage in submucosa c)oedema in submucosa (H&E stain, 40x).
|
|
Figure (10) : Histopathological changes in intestine section of mouse inoculated with DSS+bft toxin showed : a)sloughing and degenerated of villi,b)shorten villi (H&E stain, 40x).
|
|
Figure (9) Histopathological changes in liver section of mouse inoculated with DSS+bft toxinshowed:a)necrotichepatocytes ,b)dilated sinusoids with hemorrhage (H&E stain, 40x).
|
Figure (11): Histopathological changes in spleen section of mouse inoculated with DSS+bft toxin showed:a) amyloid infiltration ,b)all lymphoid follicles depleted with necrotic lymphocytes (H&E stain, 40x)
Discussion
The results of the present study demonstrated that 34 isolated B.fragilis depending on the 16S rRNA gene, these results matched with a study done by[21] who showed that19 B.fragilis were positive for the 16S rRNA gene. The results denounce that 5 isolates of B.fragilis contain the bft gene (ETBF), and the remaining isolates were NTBF. The results observed here correspond to the results reported in Baghdad (22).
As far as we know, this is the first study in Iraq focused on the purification of bft toxin and its effect on the liver, intestine, and spleen in mice. The only virulence factor identified as being unique to ETBF strains is BFT. Our study demonstrates that BFT stimulates intestine inflammation and that
biologically active BFT expression is necessary and sufficient to induce murine colitis. Metalloprotease toxins (bft) may act as virulence factors in microorganisms. In some instances, they directly damage the tissue during the infection or inactivate endogenous factors that normally are involved in the host response regulation to infections (23). Current results of the positive control in the liver section of mice disagreed with a study done by (24) who reported that neither morphological differences nor hepatocellular necrosis was observed in the DSS-treated groups of mice. The typical histological changes induced by acute DSS include mucin and goblet cell depletion, epithelial erosion, ulceration, and infiltration of granulocytes into the lamina propria and submucosa resulting in immune responses (25, 26). The successful and reproducible induction of DSS-induced colitis depends on several critical variables, including the DSS source, molecular weight, concentration, duration, mouse strain, source, age, gender, and body weight as well as ambient factors like the status of the vivarium's hygiene (27). Third group, histopathological changes for the liver section shown in Figure (7): necrotic hepatocytes and dilated sinusoids with hemorrhage, whereas a study by (28) reported that ETBF colonization alone of mice induce splenomegaly in mice. ETBF colonization with gnotobiotic mice, histopathological changes in the liver showed diffuse congestion with few mononuclear inflammatory cells.
Conclusion:
There were significant differences between the three genetic lines on egg external traits and between the collecting age and their infarctions. May its helpful for future studies to establish lines special for egg production, us to make studies on molecular levels.
conflict of Interest
The author(s) declared that there is no conflict of interest.
Reference
دراسةتجریبیةلتأثیرالذیفان bft المعزول والمنقى من العزلاتEnterotoxigenic B.fragilis
على الکبدوالامعاء والطحال فی الفئران
حسین علی خلیفة, اشواق باسم جاسم
معهد الهندسة الوراثیة, جامعة بغداد.
الخلاصة
شملت هذه الدراسة ثلاث اجزاء: عزل جرثومة Enterotoxigenic B.fragilis من 94 عینة براز تم جمعها من مستشفیات مختلفة فی مدینة بغداد من بدایة آذار / 2020 حتى نهایة نیسان / 2021. تم زرع عینات البراز على وسط BBE فی حالة لاهوائیة لمدة 24-48 ساعة. تم التعرف على بکتیریا B.fragilis بناءً على الخصائص المورفولوجیة على وسائط BBE: مستعمرات دائریة صغیرة محدبة باللون الرمادی تحیط بالمنطقة السوداء حول المستعمرات والطرق الجزیئیة باستخدام جینات محددة 16S rRNA , bft. اظهرت النتائج34عزلة B.fragilis کانت موجبة لجین 16S rRNA و 5 B.fragilisموجبة لجین bft صنفت على أنها سموم معویة (ETBF). تم تنقیة العزلة ETBF التی کانت موجبةللجینات bft و 16S rRNAباستخدام طریقة Van Tassel .تم تقسیم ثلاثین ذکرمن الفئران إلى ثلاث مجموعات مع 10 فئران لکل مجموعة المجموعة الأولى کمجموعة سیطرة .المجموعة الثانیة عبارة عن فئران تحکم إیجابیة یتم تناولها یومیًا 2٪ کبریتات دیکستران الصودیوم ، فئران المجموعة الثالثة تم إعطاؤها بواسطة أنبوب معدی 2٪ DSS لمدة 10 أیام بعد 10 أیام الفئران تم إعطاؤها 20 میکروغرامًا من الذیفان bft عن طریق أنبوب المعدةلمدة 30 یوم. فی نهایة التجربة ، قُتلت جمیع مجموعات الفئران بأخلاق القتل الرحیم. تمت إزالة عینات الأنسجة (الکبد والأمعاء والطحال) من الفئران. تم تثبیت الأعضاء فی 10٪ فورمالین مخزون محاید للتقنیات النسیجیة.التغیرات النسیجیة المرضیة فی المجموعة الثالثة فی الکبد فی الفئران أظهرت: خلایا کبدیة نخریة وأشباه جیوب متوسعة مصحوبة بنزیف.کما أظهرت التغیرات النسیجیة المرضیة فی الجزء المعوی من الفئران: تقشر وتآکل الزغابات وتقصیر الزغابات. أظهرت التغیرات النسیجیة المرضیةفی الطحال : تسلل أمیلوید (الداء النشوانی) وجمیع البصیلات اللمفاویة مستنفدة مع الخلایا اللیمفاویة النخریة.
الکلمات المفتاحیة: Bacteroides fragilis ذیفان bft, الکبد.
| Article View | 576 |
| PDF Download | 373 |