Molecular detection of Methicillin-Resistant Staphylococcus aureus isolated from Subclinical Mastitis Cows in Basrah Province.

Document Type : Research Paper

Author

Abstract
Out of 200 milk samples collected from apparently normal cows in Basrah province from 21 November 2023 to 6 February 2024, 95 (48)% were positive for the CMT test. This study used various techniques to detect the presence of staphylococcus aureus, including conventional microbiological assays (mannitol salts agar and CHROMagar™ Staph aureus) and molecular methods (amplifying the nuc gene using polymerase chain reaction ). The percentage of S. aureus isolates was 38 (19 % ).
From 38 ( 19 %) S. aureus isolates, 27 (71%) carried the mecA gene, 6 (16%) carried pvl, while none of the isolates carried the mecC gene.

Keywords

Crossmark

Article Title العربیة

الكشف الجزيئي عن المكورات العنقودية الذهبية المقاومة للميثيسيلين المعزولة من الابقار المصابة بالتهاب الضرع تحت السريري في محافظة البصرة .

Abstract العربیة

تم جمع (٢٠٠) عينة حليب من ابقار سليمة ظاهريأ من اماكن مختلفة في محافظة البصرة للفترة من ٢١ تشرين الثاني ٢٠٢٣ لغاية ٦ شباط ٢٠٢٤. تم تشخيص التهاب الضرع تحت السريري ( SCM ) ٩٥( ٤٨%) من العينات التي تم فحصها باستخدام اختبارالتهاب الضرع كاليفورينا (CMT ). تم استخدام تقنيات مختلفة للكشف عن وجود المكورات العنقودية الذهبية وهذه التقنيات شملت الاختبارات البكتيريولوجية التقليدية والتي تتضمن الزرع على اوساط تفرقية وانتخابية والتقنيات الجزيئية . تشير نتائج الاختبارات البكتيريولوجية التقليدية الى تحديد ٧٠(٣٥%) عزلة تم اعتبارها S.aureus بينما بالنسبة للطرق الجزيئية باستخدام البادٸ الخاص بتفاعل البلمرة لجين (nuc) لتاكيد العزلات, وكانت نتيجة هذه التقنية تأكيد ٣٨ (١٩%) من العزلات على انها S. aureus تم تقيم المقاومة الوراثية للميثيسيلين .
خضعت هذه العزلات لتفاعل البلمرة للكشف عن الجينات المقاومة للميثسيلين ( mecA,mecC ) و(pvl) . نتائج البلمرة اكدت أن ٢٧) ٧١% ) عزلة تمتلك الجين المقاوم للميثيسيلين (mecA gene ) في حين أن النسبة الأقل كانت ٦( ١٦% ) تمتلك ( pvl gene) .

Keywords العربیة

التهاب الضرع السريري
الابقار
المكورات العنقودية المقاومة للمثسلين

Introduction

Bovine mastitis is among the most common diseases impacting dairy cows globally (1 , 2) . Visible abnormalities, such as redness, swollen udder, and fever, readily identify clinical bovine mastitis in dairy cows. The cow's milk appears watery with flakes and clots (3) .

Contrary to clinical mastitis, sub-clinical mastitis has no apparent abnormalities in the udder or milk; it is associated with less milk production and an elevation in somatic cell count (SCC). (4) .

Staphylococcus aureus is frequently associated with subclinical mastitis and causes significant financial losses due to decreased milk quantity and quality (5) . S. aureus produces several virulence factors, such as enterotoxins and leukocidins, that impart immune system resistance and facilitate adaptability. These substances help the bacterium avoid the host immune system and form an intramural infection.

Therefore, S. aureus's diversity of virulence factors significantly influences how animal infections develop. Two significant public health issues are the discovery of bacteria resistant to antibiotics for bovine mastitis and the possibility that unpasteurized dairy products could spread to humans.

Another danger in the community is antibiotic residues in milk, and the abuse of antibiotics to treat mastitis can lead to resistance (8). Since β-Lactam antibiotics have long been misused on dairy farms to treat mastitis, the rise of resistant bacteria and veterinary medications in milk poses serious public health problems. (9).

As a result, MRSA linked to livestock poses a global risk to both humans and animals. A primary reason for methicillin resistance in staphylococci is the expression of the mecA gene or its homolog mecC. It contains various staphylococcal cassette chromosomes, known as SCCmec, which are based on a mobile genetic element (10) . A trans-peptidase that is only 63% identical to PBP2a, encoded by mecA, is encoded by the novel genetic determinant known as mecC, defined as mutations in mecA.

MRSA isolates with mecA positive are seen in cattle and other animals and also spread from other Staphylococci or livestock-associated MRSA to human MRSA. (11) . For instance, cytotoxin, known as Panton-Valentine Leukocidin (PVL), encoded by the pvl gene, a virulence feature, is implicated in leucocyte destruction and necrosis of the tissues. (12) . This study aimed to identify subclinical mastitis in cows caused by Staphylococci. (in particular S. aureus). Moreover, to determine the virulence genes of MRSA among S. aureus isolates.

Material and Methods

Samples collection

Out of 200 milk samples were collected from raw milk cows from different parts of Basrah province. The sample collection started on 21 November 2023 and ended on 6 February 2024. The raw milk samples were submitted to CMT.

Microbiological techniques

Isolation and identification of bacteria: All samples were primarily submitted to the California mastitis test (CMT) and categorized by CMT scores (13). The positive CMT samples were transported immediately to the Central Research Unit in the Veterinary College using an icebox. Upon laboratory arrival, the milk sample was inoculated in Brain Heart Infusion broth (BHI) and incubated at 37°C overnight. The preincubated samples were subcultured on Mannitol Salt Agar (Himedia, India) and CHROMagar™ Staph aureus. (Chromogenic Media "pioneer/ France). The plates were incubated aerobically for 24 hours at 37°C. Gram's stain identified the suspected colonies on CHROMagar™ Staph aureus.

Molecular techniques

Genomic DNA extraction: According to the manufacturer's recommendations, a DNA kit (Geneaid, USA) was used to extract the genomic DNA of probable S. aureus isolates.

Detection of the nuc gene:Table (1) shows the primer of the nuc gene. The amplification conditions were implemented in (14).

Gene Primer sequences (5 ⟶ 3) Length Product size References
nuc F: 5´- GCTTGCTATGATTGTGGTAGCC 3' 22 423 bp 14
R: 5'- TCTCTAGCAAGTCCCTTTTCCA 3' 22
mecA F:5'-TCCAGATTACAACTTCACCAGG-3' 22 162bp 15
R:5'-CCACTTCATATCTTGTAACG-3 20
mecC F:5'-GAAAAAAAGGCTTAGAACGCCTC-3' 23 138 bp
R:5'-GAAGATCTTTTCCGTTTTCAGC-3' 22
Pvl F: 5' – GCTGG;ACAAAACTTCTTGGAATAT – 3 24 85bp
R:5'– GATAGGACACCAATAAATTCTGGATTG – 3' 27
Table (1).Sequence of primer pair for amplifying nuc, mecA, mecC, and pvl genes.

Molecular detection of MRSA:Detecting the mecA, mecC, and pvl genes for the molecular confirmation of MRSA isolates. Table (1) Provided primer sequences. The PCR heat cycling protocol comprised based on (15).

Results

Subclinical mastitis: Ninety-five (48%) percent of the California Mastitis Test indicated positive for CMT. (table 2) illustrated the percentage according to CMT results. Figure (1). Using conventional microbiological techniques, The rate at which suspected S. aureus isolates using Mannitol Salts Agar and CHROMagar™ Staph aureus was 90 (45% ) and 70 ( 35%), respectively, as shown in Table (3). All suspected isolates were subjected to PCR using the nuc gene Table (3), Figure (2), and Figure (3). The molecular assay results were 38 (19%) characterized as S. aureus. It was determined that the difference between these outcomes was statistically significant (p< 0.05).

Total number Positive results (%) Trace (%) Weak (%) Distinct (%) Strong (%)
200 95 (48%) 6 (3%) 39( 20%) 35 (18%) 15 ( 8%)
Chi-square: 126,632 degrees of freedom: 3, p-value: 0,001
Table (2).Results of the CMT test based on the degree of gel formation

Figure (1). Results of California Mastitis test based on the degree of gel formation

Total number of milk samples Number of suspected isolates of Staphylococcus aureus Confirmed isolates by Molecular detection of nuc gene
Mannitol Salts Agar CHROMagar™ Staph aureus
No No ٪ No ٪ NO ٪
200 90 45 70 35 38 19
Chi-square: 20,848 degrees of freedom: 2, p-value: 0,001
Table (3).Shows the number of S. aureus isolates identified by cultural and traditional microbiological techniques and molecular detection of the nuc gene.

Figure (2).A: Staphylococcus aureus appeared as golden yellow colonies on Mannitol Salts Agar,B:Chromogenic agar: colonies seemed mauve (pink), C: Gram-positive cocci.

Figure (3).Electropherogram of nuc gene amplification. The PCR product was run on 1 % agarose gel, stained with ethidium bromide. L: mean Ladder and nuc gene product size approximately (423 bp).

Detection of MRSA isolates: Methicillin-resistant S. aureus (MRSA) multiplex PCR virulence gene results for mec A and pvl genes revealed that 71% of the isolates were mecA and 16% were pvl, but none had mecC. Table (4), figure (4) A and B.

No. of S. aureus No. of mec A No. of mec C No. of pvl
No No ٪ No ٪ NO ٪
38 27 71 0 0 6 16
Table (4).Showed percentage of ( mec A, mec C, and pvl ) genes among S. aureus isolates.

Figure (4).A:Percentage of ( mec A, mec C, and pvl ) genes in S. aureus isolates

Figure (4).B: Electropherogram of amplification of mecA,mecC, and pvl genes. The PCR products were run on a 1 % agarose gel stained with ethidium bromide. L: mean Ladder, mecA (162 bp, pvl: 85 bp ), whereas none of the isolates carried mec C.

Discussion

The dairy business suffers the most significant financial losses globally due to bovine mastitis, which also risks consumers' health (16) . However, subclinical mastitis in dairy cattle is a significant and quiet issue that causes farmers to suffer more economic losses. In addition, it leads to low milk yield and quality, considered the first disease that causes significant loss to owners (17) .

In this study, the California mastitis test results revealed that 46 % of the samples tested positive for CMT. This result agrees with (18) ., who found that the frequency of subclinical mastitis was 42.5 %. In Iraq, studies like (19) . found that 38.89% of the samples in Al Sulaimaniyah Province had subclinical mastitis. In other studies, CMT varied from 38% to 56.6% compared to other research in Basrah (20 , 21). Staphylococcus aureus (S. aureus) is considered among the most essential udder pathogens, causing significant economic losses worldwide (22) . The isolation rate of Staphylococcus aureus from SCM was 19 %. This incidence was consistent with a study conducted in Nepal that found that 15.2% of milk tested positive for CMT had S. aureus (23) . However, our study's S. aureus prevalence is more than that of a study by (24) ., in which 6 (2.8%) cows with SCM had S. aureus.

This incidence was consistent with a study conducted in Nepal that found that 15.2% of milk tested positive for CMT had S. aureus contamination (23) .. The prevalence of S. aureus is higher than what was found in a study by (24)., where 6 (2.8%) cows with SCM had S. aureus contamination.

The difference in S. aureus prevalence between this study and previous research could be explained by variations in isolation technique, geographic areas, and sample characteristics (size, season, and type).

mecA is the most significant approach to MRSA isolation (25) .. The lowest β-lactam potential altering protein (PBP2a) on SCCmec-resistant genomes is encoded by the mecA. (26) .. PCR results indicated that 71% of MRSA isolates carried the mecA gene. This rate agrees with (27) ., who reported that the mecA percentage was 86.66%. Moreover, Hammadi and Yousif announced that 88% of S. aureus cases were MRSA (28) .; in contrast, (29) observed that MRSA is found in just 10% of S. aureus infections. Meanwhile, the mecC gene was not found in any of the isolates in this study. This result agrees with (30 , 31) , who reported that none of the isolates carried the mecC gene. These findings disagree with (32) who reported that 3 (12.5%) were positive for mecC. One of S. aureus's main virulence factors is PVL. It makes it more harmful by hastening apoptosis and eliminating mononuclear and polymorphonuclear cells (33) . The occurrence of the pvl gene in MRSA isolates has not been extensively studied. According to earlier research, the pvl gene's predominance ranges from 2% to 35%. (34 , 35). Conversely, this study's findings for the pvl gene were 6 (16%), near the lower limit from other studies. Ultimately, this study showed that MRSA was common in cows with subclinical mastitis. This major public health issue should make veterinarians more knowledgeable about antibiotics.

Conflicts of interest

The authors declare that there is no conflict of interest.

Ethical Clearance

This work is approved by The Research Ethical Committee.

References

  1. Jamali, H.; Barkema, H. W.; Jacques, M.; Lavallée-Bourget, E. M.; Malouin, F., Saini ;V.,Dufour, S. (2018). Invited review: Incidence, risk factors, and effects of clinical mastitis recurrence in dairy cows. Journal of Dairy Science, 101(6), 4729-4746.
  2. Cobirka, M.; Tancin, V.; and Slama, P. (2020). Epidemiology and classification of mastitis. Animals, 10(12), 2212.
  3. Khan, M. Z. and Khan, A. (2006). Basic facts of mastitis in dairy animals: a review. Pak. Vet. j.; 26(4): 204-208.
  4. Abebe, R. ; Hatiya, H.;Abera, M.; Megersa, B.; and Asmare, K. (2016). Bovine mastitis: prevalence, risk factors and isolation of Staphylococcus aureus in dairy herds at Hawassa milk shed, South Ethiopia. BMC Veterinary Research, 12, 1-11.
  5. Gonçalves, J. L.; Kamphuis, C.; Martins, C. M. M. R.;Barreiro, J. R.;Tomazi, T., Gameiro; A. H. ; and Dos Santos, M. V. (2018). Bovine subclinical mastitis reduces milk yield and economic return. Livestock Science, 210, 25-32.
  6. Rossi, B. F.; Bonsaglia, E. C.; Pantoja, J. C.;Santos, M. V.; Gonçalves, J. L.; Júnior, A. F.; and Rall, V. L. (2021). Association between the accessory gene regulator (agr) group and the severity of bovine mastitis caused by Staphylococcus aureus. Journal of Dairy Science, 104(3), 3564-3568.
  7. Magro, G.; Biffani, S.; Minozzi, G.; Ehricht, R., Monecke, S.; Luini, M.;and Piccinini, R. (2017). Virulence genes of S. aureus from dairy cow mastitis and contagiousness risk. Toxins, 9(6), 195.
  8. De Jong, A.; El Garch, F.;Simjee, S.;Moyaert, H.; Rose, M.; Youala, M.; and Vet Path Study Group. (2018). Monitoring of antimicrobial susceptibility of udder pathogens recovered from cases of clinical mastitis in dairy cows across Europe: VetPath results. Veterinary microbiology, 213, 73-81.
  9. Khairullah, A. R.; Ramandinianto, S. C.; and Effendi, M. H. (2020). A review of livestock-associated methicillin-resistant Staphylococcus aureus (LA-MRSA) on bovine mastitis. Syst Rev Pharm, 11(7), 172-183.
  10. Lakhundi, S.; and Zhang, K. (2018). Methicillin-resistant Staphylococcus aureus: molecular characterization, evolution, and epidemiology. Clinical microbiology reviews, 31(4),10-1128.
  11. Vandendriessche, S.; Vanderhaeghen, W.; Soares, F. V.; Hallin, M.;Catry, B.; Hermans, K.; and Denis, O. (2013). Prevalence, risk factors, and genetic diversity of methicillin-resistant Staphylococcus aureus carried by humans and animals across livestock production sectors. Journal of Antimicrobial Chemotherapy, 68(7), 1510-1516.
  12. Wu, Z.; Li, F.; Liu, D.;Xue, H.; and Zhao, X. (2015). Novel type XII staphylococcal cassette chromosome mec harboring a new cassette chromosome recombinase, CcrC2. Antimicrobial agents and chemotherapy, 59(12), 7597-7601.
  13. Philpot, W.N. and Nickerson, S.C. (1991) Mastitis: Counter Attack: A Strategy to Combat Mastitis. Badson Brothers Co., Illinois.
  14. Wongboot, W.; Chomvarin, C.; Engchanil, C.; and Chaimanee, P. (2013). Multiplex PCR for detecting superantigenic toxin genes in methicillin-sensitive and methicillin-resistant Staphylococcus aureus isolated from patients and carriers of a hospital in northeast Thailand. Southeast Asian J. Trop. Med. Public Health, 44(4), 660-671.
  15. Stegger, Á.; Andersen, P. S.; Kearns, A.; Pichon, B.;Holmes, M. A.; Edwards, G.; and Larsen, A. R. (2012). Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecALGA251. Clinical Microbiology and Infection, 18(4), 395-400.
  16. Kumar, R.; Yadav, B.R.; and Singh, R.S. (2010). Genetic determinants of antibiotic resistance in Staphylococcus aureus isolates from milk of mastitic crossbred cattle, Current Microbiology, 60, 379–386.
  17. Kumari, T.; Bhakat, C.; and Choudhary, R. K. (2018). A review on subclinical mastitis in dairy cattle. Int. J. Pure Appl. Biosci, 6(2), 1291-1299.
  18. Hashemi, M.; Kafi, M.; and Safdarian, M. (2011). The prevalence of clinical and subclinical mastitis in dairy cows in the central region of Fars province, south of Iran.
  19. Hussein, S. A. (2012). Prevalence and bacterial etiology of subclinical mastitis in dairy cows in Al Sulaimaniyah district. Kufa Journal For Veterinary Medical Sciences, 3(1), 190-203.
  20. Al-Iedani, A.A.; and Ghazi, S.S. (2016). Evaluation of raw milk from local markets and milk samples taken directly from cows in Basrah-Iraq. Journal of Agriculture and Veterinary Science, 9(12): 59-64.
  21. Al-Iedani, A. A. (2016). Phenotypic study on the capacity of biofilm production in S. aureus isolated from bovine subclinical mastitis and their impact on resistance to antimicrobials. Basrah Journal of Veterinary Research, 15(2): 111–127.
  22. Boss, R;Cosandey, A.; Luini, M.;Artursson, K.,; Bardiau, M.; Breitenwieser, F.; and Graber, H. U. (2016). Bovine Staphylococcus aureus: Subtyping, evolution, and zoonotic transfer. Journal of Dairy Science, 99(1), 515-528.
  23. Shrestha, A.; Bhattarai, R. K.;Luitel, H.; Karki, S.; and Basnet, H. B. (2021). Prevalence of methicillin-resistant Staphylococcus aureus and pattern of antimicrobial resistance in mastitis milk of cattle in Chitwan, Nepal. BMC Veterinary Research, 17, 1-7.
  24. Király, J.; Hajdučková, V.; Gregová, G.; Szabóová, T.; and Pilipčinec, E. (2024). Resistant S. aureus Isolates Capable of Producing Biofilm from the Milk of Dairy Cows with Subclinical Mastitis in Slovakia. Agriculture, 14(4), 571.
  25. Dive, G.;Bouillon, C.; Sliwa, A.; Valet, B.; Verlaine, O.; Sauvage, E. ; and Marchand-Brynaert, J. (2013). Macrocycle-embedded β-lactams as novel inhibitors of the Penicillin Binding Protein PBP2a from MRSA. European journal of medicinal chemistry, 64, 365-376.
  26. Jani, M.; Sengupta, S.; Hu, K.; and Azad, R. K. (2017). Deciphering pathogenicity and antibiotic resistance islands in methicillin-resistant Staphylococcus aureus genomes. Open Biology, 7(12), 170094.
  27. Ibrahim, H. K.; Madhi, K. S.;Baqer, G. K.; and Gharban, H. A. (2023). Effectiveness of raw bacteriocin produced from lactic acid bacteria on biofilm of methicillin-resistant Staphylococcus aureus. Veterinary World, 16(3), 491.
  28. Hammadi, K. M.; and Yousif, A. A. (2013). Prevalence of clinical and subclinical ovine mastitis caused by Staphylococcus aureus. Al-Anbar J. Vet. Sci, 6(1).
  29. Al-Jebouri, M.M.; and Mdish, S.A. (2013) Antibiotic resistance pattern of bacteria isolated from patients of urinary tract infections in Iraq. Open J. Urol., 3(7): 124–131.
  30. Platenik, M. O.; Archer, L.; Kher, L.; and Santoro, D. (2022). Prevalence of mecA, mecC and Panton-Valentine-Leukocidin genes in clinical isolates of coagulase positive staphylococci from dermatological canine patients. Microorganisms, 10(11), 2239.
  31. Doğan, E.;Kilic, A.; Türütoğlu, H.; Öztürk, D., and TÜRKYILMAZ, S. (2016). Screening of Staphylococcus aureus isolates for mecA and mecC genes carriage. Ankara Üniversitesi Veteriner Fakültesi Dergisi, 63(4), 389-399.
  32. Meharaj, S. S.;Jayanthi, S.;Danisvijay, D.; Sujhithra, A.; and Perumal, J. (2023). Multiplex PCR based detection of mecA, mecC and PVL gene in analysis of prevalence, circulation, transmission of MSSA/MRSA strains in a tertiary care hospital. IP International Journal of Medical Microbiology and Tropical Diseases, 5(3), 155-159.
  33. Vandenesch, F.; Naimi, T.; Enright, M. C.;Lina, G.; Nimmo, G. R.; Heffernan, H.; and Etienne, J. (2003). Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: worldwide emergence. Emerging infectious diseases, 9(8), 978.
  34. Melles, D. C.;Gorkink, R. F.; Boelens, H. A.;Snijders, S. V.; Peeters, J. K.; Moorhouse, M. J.; and van Belkum, A. (2004). Natural population dynamics and expansion of pathogenic clones of Staphylococcus aureus. The Journal of clinical investigation, 114(12), 1732-1740.
  35. Okon, K. O.; Basset, P.; Uba, A.;Lin, J.; Oyawoye, B.;Shittu, A. O.; and Blanc, D. S. (2009). Cooccurrence of predominant Panton-Valentine leukocidin-positive sequence type (ST) 152 and multidrug-resistant ST 241 Staphylococcus aureus clones in Nigerian hospitals. Journal of Clinical Microbiology, 47(9), 3000-3003.

  • Receive Date 06 December 2024
  • Revise Date 24 January 2025
  • Accept Date 26 February 2025
  • Publish Date 31 March 2025