Introduction
Raw meat is regarded as an ideal medium for the growth of various types of microbes, including fungi and bacteria. During the slaughtering process, the digestive systems of slaughtered animals are the most important source of contaminating microbes ( 1 ). The public health system is exposed to various virulent bacteria due to unauthorized slaughter in the open air, poor hygiene in slaughterhouses, and improper processing in food sites. Meat's microbiological characteristics are an indirect indicator of its level of poor sanitation. Inefficient carcass handling can lead to higher total bacterial colonies in meat ( 2 ).
In recent years, foodborne pathogens have become a major public health concern worldwide, resulting in high incidence and mortality ( 3 ). C. perfringens is an important anaerobic pathogen that causes foodborne gastrointestinal illness in humans and animals, and meat products are the most common vectors of C. perfringens type A food poisoning ( 4 ). C. perfringens is known for its rapid growth and produces more than 15 toxins that cause a range of different diseases in humans and animals. Of the highly toxic toxins that commonly cause damaging effects are Alpha toxin, Beta toxin, Epsilon toxin, Enterotoxin, Beta2 toxin, and Theta toxin. These are known for their variety and wide characteristic features which together hamper the control and treatment efforts ( 5 ). Furthermore, C. perfringens food poisoning ranks among the most common foodborne illnesses worldwide ( 6 ). C. perfringens affects both animals and humans through toxic production, which results in more than 20 different types of toxins ( 7 ).
A system can differentiate C. perfringens strains by identifying specific toxins as identification markers. The toxinogenic character of C. perfringens strains extend their classification into seven toxinotypes (A, B, C, D, E, F, G) through toxin-encoding gene detection, which includes CPA, CPB, ETX, ITX, CPE, and NetB ( 8 ). C. perfringens Type A infection has been identified as a common cause of food-borne disease in industrialized countries and is a leading cause of food poisoning cases in the USA, responsible for approximately 14% of food poisoning cases ( 9 ). Local studies on the quality of meat production chains, especially about C. perfringens and toxinotyping, are limited in the Basrah governorate. The study aimed to detect C. perfringens in raw meat and tools in butcher shops in local markets of Basra Governorate.
Materials and Methods
Sample collection: From June to August 2024, 75 samples were collected from butchers' markets. Using sterile swabs, equivalent areas (2.5 CM) of meat surface (located on the carcasses) and similarly the butcher’s tools were rubbed evenly, and then the swabs were inoculated into a thioglycolate medium containing tubes. The cultures were transported to the College of veterinary medicine central laboratory and cultivated under anaerobic conditions for 48 hrs. at 37°C using an anaerobic jar and gas bags. The samples included 50 samples of slaughtered sheep meat and 25 samples of tools, distributed as 15 samples of knives and 10 samples from the butcher's table. The samples were selected from different areas of the Local markets of Basrah Governorate. Within two hours after slaughtering, the samples were collected and brought to the laboratory in sterile tubes containing thioglycolate broth to create anaerobic conditions ( 10 )
Culture and growth conditions: Using an anaerobic jar and anaerobic CO2 gas bags (CampyGenTM, Thermo Scientific USA), the thioglycolate broth samples were incubated at 37°C for 24 to 48 hours under anaerobic conditions. Thioglycolate samples were then spread out on chromogenic agar medium for C. perfringens (CHROMagarTM, France) using sterile cotton swabs, put in the anaerobic jar with anaerobic bags, and incubated for 48 to 72 hours at 37°C. Additional phenotypic analysis, such as colony morphology, Gram staining, spore staining, and growth on blood agar, was performed on selected colonies ( 11 , 12 , 13 )
DNA extraction: In accordance with the manufacturer's instructions, the Wizard Genomic isolation kit from PromegaTM, USA, was used to perform the genomic DNA extraction. Following DNA extraction, a nanodrop spectrophotometer was used to assess the isolated DNA's concentration and purity. The isolated DNA was kept at -20 °C till use.
Molecular characterization: C. perfringens species-specific primers targeting the 16S rRNA gene were used to perform PCR on C. perfringens ( 13 ). In addition, the toxin gene cpa was detected using PCR primers targeting the cpa gene ( 14 ). The primer sequences and corresponding lengths of the amplicons are shown in Table 1. `PCR for the two targets was performed in a total reaction volume of 25 μl, including 12.5 μl of GoTaq® Green Master Mix (Promega Corporation, USA), 3 μl of purified genomic DNA (100–150 ng total), 1.5 μl of each primer (0.3 μmol), and 6.5 μl of sterile distilled water. Thirty-five amplification cycles (cycle steps are listed in Table 1) were performed after initial denaturation at 95 °C for 5 min. There was a final extension step of five minutes at 72°C.
| Gene | Primers | Sequence (5’-3’) | Amplification (35 cycles) | size | Ref. | ||
|---|---|---|---|---|---|---|---|
| Denaturation | Annealing | Extension | |||||
| 16S rRNA | C._perfring16S-F | AAAGATGGCATCATCATTCAAC | 94°C 1min | 50°C 1min | 72°C 1min | 279bp | ( 14 ) |
| C._perfring16S-R | TACCGTCATTATCTTCCCCAAA | ||||||
Gel electrophoresis: To prepare 1.5% gel electrophoresis, 1.5 g of agar beads were dissolved in 100 ml of TBE solution. Following sample loading and gel electrophoresis, the gel was placed under a UV light source to examine the final product. A digital camera was then used to take pictures. The DNA marker (100-3000 base pairs) was used to visualize the PCR bands.
Results
Growth on chromogenic agar
The results showed that 15 samples out of a total of 75 samples, at a rate of 20%, were positive for C. perfringens. Ten meat surface samples and five butcher’s tool samples, including three knives as well as two butcher tables, showed C. perfringens presence. The positive samples showed C. perfringens colonies on the chromogenic agar and had rod-shaped Gram-positive bacteria when looked at under a microscope (Figures 1 and 2). The positive results from the analyzed samples composed 20% of the full set of tested specimens.

Figure 1.Red-colored colonies CHROM agar C. perfringens

Figure 2.Gram-staining demonstrating Rod-shaped (bacilli) organisms with purple coloration.
Molecular Identification of C. perfringens Using 16S rRNA: Conventional PCR testing of the 16S rRNA gene showed that of the 15 samples analyzed through PCR testing, 15 (100%) generated specific band patterns of 279 base pairs in length. The observed band matched the DNA ladder positioning at the expected region, confirming the expected results as shown in Figure 3 (Table 2).

Figure 3.PCR amplification product of 16S rRNA gene showing at 279 bp. Lane (M) shows a DNA marker 100 to 3000 bp ladder.
| Gene | Primers | Sequence (5’-3’) | Amplification (35 cycles) | size | Ref. | ||
|---|---|---|---|---|---|---|---|
| Denaturation | Annealing | Extension | |||||
| cpa | CPA-F | GTTGATAGCGCAGGACATGTTA | 95°C 1min | 56.2°C 20s | 72°C 1min | 402bp | ( 15 ) |
| CPA-R | CATGTAGTCATCTGTTCCAGCATC | ||||||
Detection of the cpa gene: PCR amplification of the cpa gene showed a 402 base pair PCR product in all the positive C. perfringens isolates 15, 100%) (Figure 4)(Table 3).

Figure 4.PCR amplification product of cpa gene showing at 402 bp. Lane (M) shows a DNA marker 100 to 3000 bp ladder.
| gene | samples | |
|---|---|---|
| meat | Butchers' tools | |
| 16S rRNA | 10/50 (20%) | 5/25 (20%) |
| cpa | 10/50 (20%) | 5/25 (20%) |
Discussion
C. perfringens is regarded as one of the human food poisoning and enteric-disease causing pathogens in animals. In addition, the ability to form spores has complicated the control measures and posed additional public health alerts. Meat contamination in C. perfringens is one of the indicators of potential infection or food poisoning in animals. This study aimed to understand the degree of contamination of meat and butcher’s tools in C. perfringens and the dominant toxinotyping among the contaminating isolates. The isolation method we used ensured the screening of a similar surface area across all samples. This is important to solidify our results and prevent any source of sampling errors. C. perfringens isolates obtained in this study were screened for the toxin gene cpa linked to human infection. The results showed a high level of C. perfringens contamination in the samples. This is alarming to public health. Our results were similar to those of previous studies. Conducted by Jang et al. ( 16 ) found that 10% of beef meat in Seoul, Korea, was contaminated with C. perfringens and only tested positive for the cpa gene. Others have demonstrated the presence of this gene in beef from four different types of meat markets in Seoul, Korea (12.20%) ( 17 ). C. perfringens has been studied in other animals such as birds. The results of the current study are also in agreement with ( 18 ), who analyzed 53 isolates of C. perfringens from poultry of different parts of Sweden by PCR for toxin typing and reported that all the isolates belonged to Toxinotype A of C. perfringens with the gene coding for alpha-toxin production. Also, Dar et al. ( 19 ) found that all isolates were C. perfringens type A by a multiplex PCR, and the cpa gene was the dominant gene.
In Iraq, we only found a limited number of studies about C. perfringens and meat contamination. During an investigation, for abomasal lesions in slaughtered animals (Al-Qasim, Babylon, Iraq), the results revealed that C. perfringens was identified in 14% of cases, mostly from ulcers (42.8%) and nodules (57.14%) ( 20 ). Several pathogenic bacteria were detected in another study of bacterial contamination in frozen buffalo meat (Hama, Syria, and Mosul, Iraq). The samples comprised 60 specimens from meat shops in Hama City, Syria, and a second batch of 40 specimens from shops in Mosul City, Iraq. The detected pathogens were E. coli, Staphylococcus aureus, Klebsiella pneumoniae, and C. perfringens, among others ( 21 ). In Basrah, there were limited studies that did not tackle the toxinotyping of isolates, as they indicated the presence of a number of C. perfringens in sheep and beef meat by PCR ( 1 ). To our knowledge, our study is the first to link C. perfringens meat pollution to toxinotyping in the Basrah governorate.
Our findings align with those of ( 22 ) who identified C. perfringens in meat and fast food in Duhok, Iraq. Type A was the predominant strain, although Type D and Type F strains were identified in beef kebabs and chicken shawarma, respectively. The contamination in C. perfringens is complicated by the fact that it can survive in canned food under anaerobic conditions and develop spores that can spread to other forms of food. A study about bacteria in canned foods (Ibrahim Khalil Border, Iraq) indicated that Bacillus cereus, Clostridium sporogenes, and Clostridium perfringens were commonly identified ( 23 ).
The limitations of our study include the limited number of samples and the fact that other Clostridial species were not included, such as Clostridium difficile, and Clostridium septicum. Furthermore, the anerobic nature of C. perfringens has limited our ability to extend the geographical area for sample collection. Future studies should consider a larger sample size and a broader range of Clostridial species to provide a more comprehensive understanding of the topic. Collectively, this study's findings necessitate further analysis of other types of anaerobic contaminants. In addition, there is a need for continual surveillance systems in slaughterhouses.
Conclusion
The widespread occurrence of type A of C. perfringens in meat and butchers’ tools underscores the necessity for more stringent hygiene protocols, improved storage conditions, and heightened public health awareness to avert contamination and foodborne diseases.
Conflicts of interest
The authors declare that there is no conflict of interest.
Ethical Clearance
This work is approved by The Research Ethical Committee.
References
- Ibrahim, H. K. (2017). Molecular detection of some bacteria from slaughtered sheep and cows in Basrah Province. Al-Qadisiyah Journal of Veterinary Medicine Sciences, 16(2), 131–136.https://doi.org/10.29079/vol16iss2art455.DOI
- Soliman, M., A. Shaltout, F.,& A. Ali, E. (2024). Bacteriological Quality Profiles and Prevalence of Staphylococcus aureus, Salmonella Species, and E. coli in Meat Samples of Sheep and Goats. Egyptian Journal of Veterinary Sciences, , 1-7.doi: 10.21608/ejvs.2024.312380.2317.DOI
- Husain, D. A.,& Aziz, Z. S. doon. (2022). Short Communication: Molecular study of bacteria isolated from meat and chicken frozen from Misan Governorate market in Iraq. Biodiversitas, 23(1), 81–86.https://doi.org/10.13057/biodiv/d230111.DOI
- Ghoneim, N. H.,& Hamza, D. A. (2017). Epidemiological studies on Clostridium perfringens food poisoning in retail foods. Revue Scientifique et Technique (International Office of Epizootics), 36(3), 1025–1032.https://doi.org/10.20506/rst.36.3.2734.DOI
- Ghaleb, L., AL-Wassouf, W., Jwher, D. M.,& Horani, I. (2025). Microbiological and Histopathological Study of Enterotoxemia Caused by Clostridium perfringens in Syrian Lamb. Journal of Applied Veterinary Sciences, 10(1), 1-9.http://dx.doi.org/10.21608/javs.2024.322305.142.DOI
- Lindström, M., Heikinheimo, A., Lahti, P.,& Korkeala, H. (2011). Novel insights into the epidemiology of Clostridium perfringens type A food poisoning. Food Microbiology, 28(2), 192-198.https://doi.org/10.1016/j.fm.2010.03.020.DOI
- Grenda, T., Jarosz, A., Sapała, M., Grenda, A., Patyra, E.,& Kwiatek, K. (2023). Clostridium perfringens—Opportunistic foodborne pathogen, its diversity and epidemiological significance. Pathogens, 12(6), 768.https://doi.org/10.3390/pathogens12060768.DOI
- Rood, J. I., Adams, V., Lacey, J., Lyras, D., McClane, B. A., Melville, S. B., Moore, R. J., Popoff, M. R., Sarker, M. R., Songer, J. G., Uzal, F. A., Van Immerseel, F. (2018). Expansion of the Clostridium perfringens toxin-based typing scheme. Anaerobe, 53, 5-10.https://doi.org/10.1016/j.anaerobe.2018.04.01.DOI
- Sanford, C. A., Jong, E. C.,& Pottinger, P. S. (2016). The travel and tropical medicine manual. Elsevier Health Sciences, pp.682. ISBN: 978-1-4160-2613-6.
- Al-Farhan, S., Al-Abdullah, A.,& Al-Mussawi, A. (2019). Isolation and Diagnosis of Anaerobic Bacteria of Periodontitis by Molecular Methods in Diabetic and Non-Diabetic Patients in Basra Province/Iraq. Scientific Journal of Medical Research, 03.https://doi.org/10.37623/SJMR.2019.31002.DOI
- Cappuccino, J. G.,& Welsh, C. (2018). Microbiology: A laboratory manual (11th ed.). Pearson Education Limited. ISBN 978-0-134-09863-0.
- Shaker, M. N., Hmdan, T. A.,& Issa, A. H. (2018). Isolation and diagnosis of Staphylococcus lentus from different operation theater hospitals. Sci J Med Res, 2(8), 177-181.http://dx.doi.org/10.37623/SJMR.2018.2804.DOI
- Jaber, N. N., Hadi, N. S., Mohammed, A. L., Idan, M.,& Niama, A. (2021). Vitik detection of aerobic spore-forming bacteria isolated from raw milk, skim milk powder and UHT milk. Medico-legal Update, 21(1), 679.https://doi.org/10.37506/mlu.v21i1.2390.DOI
- Wu, J., Zhang, W., Xie, B., Wu, M., Tong, X., Kalpoe, J.,& Zhang, D. (2009). Detection and toxin typing of Clostridium perfringens in formalin-fixed, paraffin-embedded tissue samples by PCR. Journal of Clinical Microbiology, 47(3), 807-810.https://doi.org/10.1128/JCM.01324-08.DOI
- Forti, K., Ferroni, L., Pellegrini, M., Cruciani, D., De Giuseppe, A., Crotti, S., ...& Cagiola, M. (2020). Molecular characterization of Clostridium perfringens strains isolated in Italy. Toxins, 12(10), 650.https://doi.org/10.3390/toxins12100650.DOI
- Jang, Y. S., Kim, D. H., Bae, D., Kim, S. H., Kim, H., Moon, J. S., ...& Seo, K. H. (2020). Prevalence, toxin-typing, and antimicrobial susceptibility of Clostridium perfringens from retail meats in Seoul, Korea. Anaerobe, 64, 102235.https://doi.org/10.1016/j.anaerobe.2020.102235.DOI
- Jeong, D., Kim, DH., Kang, IB. et al. Prevalence and toxin type of Clostridium perfringens in beef from four different types of meat markets in Seoul, Korea. Food Sci Biotechnol 26, 545–548 (2017).https://doi.org/10.1007/s10068-017-0075-5.DOI
- Engstrom, B. E., Fermer, C., Lindberg, A., Saarinen, E., Baverud, V.,& Gunnarsson, A. (2003). Molecular typing of isolates of Clostridium perfringens from healthy and diseased poultry. Veterinary Microbiology, 94, 225-235.https://doi.org/10.1016/s03781135(03)00106-8.DOI
- Dar, P. S., Wani, S. A., Wani, A. H., Hussain, I., Maqbool, R., Ganaie, M. Y., ...& Qureshi, S. (2017). Isolation, identification and molecular characterization of Clostridium perfringens from poultry in Kashmir valley, India. Journal of Entomology and Zoology Studies, 5(5), 409-414.
- Noori, S.,& Jassim, A. (2016). Isolation of Clostridium species from abomasal lesions of sheep. Kufa Journal for Veterinary Medical Sciences, 7(1B), 129-139.https://doi.org/10.36326/kjvs/2016/v7i1B4259.DOI
- Hamad, M. A., Al-Dabbagh, S. Y. A.,& Habra, N. (2011). Detection of bacteriological contamination in frozen Buffalo meat in Syria and Iraq. Baghdad Science Journal 22, 379–381.
- Mamsin, A., Barzani, K. K. M.,& Mohammed, B. T. (2024). Toxinotyping and protein-protein interaction (PPI) networks and functional annotation of the detected toxin genes of Clostridium perfringens isolated from food samples in Duhok Province, Iraq. Egyptian Journal of Veterinary Sciences, 55(4), 1083-1093.
- Mohamed-Sharif, Y. H., Mustafa, N. A., Younis, P. J.,& Tayeb, B. A. (2023). Microbial Load of Canned Foods Imported Through Ibrahim Khalil International Border, Iraq. Journal of Food Quality and Hazards Control, 10(1), 51–54.https://doi.org/10.18502/jfqhc.10.1.11989.DOI
